Dataset for CDS BAD of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0SI24_BAD-01      atgttccagatcccagagtttgagcccagtgagcaggaagactccagccc
A0A8C0SI24_BAD-02      atgttccagatcccagagtttgagcccagtgagcaggaagactccagccc
                       **************************************************

A0A8C0SI24_BAD-01      tgcaaataggggcttgggccccagccccacaggggaccggcccccaagcc
A0A8C0SI24_BAD-02      tgcaaataggggcttgggccccagccccacaggggaccggcccccaagcc
                       **************************************************

A0A8C0SI24_BAD-01      ctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcac
A0A8C0SI24_BAD-02      ctggcaagcaccagcagacggccccaggcctcctaggggaagctggtcac
                       **************************************************

A0A8C0SI24_BAD-01      cagcaggggcagccagccagccgcaaacaccatggaggcgctggggctga
A0A8C0SI24_BAD-02      cagcaggggcagccagccagccgcaaacaccatggaggcgctggggctga
                       **************************************************

A0A8C0SI24_BAD-01      gacccggagtcgccacagctcgttccccgcggggaccgacgaggatgaag
A0A8C0SI24_BAD-02      gacccggagtcgccacagctcgttccccgcggggaccgacgaggatgaag
                       **************************************************

A0A8C0SI24_BAD-01      gaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcg
A0A8C0SI24_BAD-02      gaatggaggaagaagagctcagccctttccgggggcgctcgagctcagcg
                       **************************************************

A0A8C0SI24_BAD-01      ccccccaacctctgcgcggcacggcgctacggccgcgagctccgcaggat
A0A8C0SI24_BAD-02      ccccccaacctctgcgcggcacggcgctacggccgcgagctccgcaggat
                       **************************************************

A0A8C0SI24_BAD-01      gagcgacgagttccagggctccttcaaggtgagcgccggcccccaaagca
A0A8C0SI24_BAD-02      gagcgacgagttccagggctccttcaagggacttcctcgcccgaagagcg
                       *****************************      *  ****  * *** 

A0A8C0SI24_BAD-01      tgtcgggaactgtagttccggggccgctcctctccgtcggccctgaccct
A0A8C0SI24_BAD-02      ---cggggacagcgacgcagatgcga----------------------ca
                          **** ** *     * *  **                        * 

A0A8C0SI24_BAD-01      gagtcccagggcctgccggtatctgtagtccacaccgtgcgtcagaacgt
A0A8C0SI24_BAD-02      aagccccag-------------ctgga--------cgcgcgtca------
                        ** *****             *** *        ** ******      

A0A8C0SI24_BAD-01      taaaggtcccgagttccccagatcctcgcggcgcggagcacgctggcatt
A0A8C0SI24_BAD-02      ----------------tccag-tcctggtggga-----------------
                                        **** **** * **                   

A0A8C0SI24_BAD-01      tgtgctcccgggcagtccctttcagatatccgggttctttggcttcaaca
A0A8C0SI24_BAD-02      --------------------------------------------------
                                                                         

A0A8C0SI24_BAD-01      acttcagaattcctcagttcttggactgccgtcccggcttccagaggctg
A0A8C0SI24_BAD-02      ---tcggaa----------cttggg----------------gagagg---
                          ** ***          *****                  *****   

A0A8C0SI24_BAD-01      ggtctcgggctcttccggggtcctggcgttctctccccgcgcccctggca
A0A8C0SI24_BAD-02      ------aggctc---------------------------cgcccc-gtcc
                              *****                           ****** * * 

A0A8C0SI24_BAD-01      cagtgtgtctgggacctaatcagtcccgttcctaa
A0A8C0SI24_BAD-02      cagtg-----------------------------a
                       *****                             *

© 1998-2022Legal notice