Dataset for CDS BCL2L11 of organism Canis lupus dingo

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0L5G0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C0L5G0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A8C0L5G0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C0L5G0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
                        **************************************************

A0A8C0L5G0_BCL2L11      cctctctacagacagaacagca----------------------------
A0A8C0L5G0_BCL2L11      cctctctacagacagaacagcaaggtaatcctgaaggcgaaggggaccgc
                        **********************                            

A0A8C0L5G0_BCL2L11      --------------------------------------------------
A0A8C0L5G0_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
                                                                          

A0A8C0L5G0_BCL2L11      --------------------------------------------------
A0A8C0L5G0_BCL2L11      cccttttgctaccagatccccgcttttcatctttgtgagaagatcctccc
                                                                          

A0A8C0L5G0_BCL2L11      ----------------------------------------agacaggagc
A0A8C0L5G0_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
                                                                **********

A0A8C0L5G0_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C0L5G0_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                        **************************************************

A0A8C0L5G0_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
A0A8C0L5G0_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
                        **************************************************

A0A8C0L5G0_BCL2L11      aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttg
A0A8C0L5G0_BCL2L11      aggctgtacctgcagatatgcgcccggagatatggattgcacaagagttg
                        **************************************************

A0A8C0L5G0_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagg--------
A0A8C0L5G0_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaaggagggtaatgat
                        ******************************************        

A0A8C0L5G0_BCL2L11      gtctttttgaataatta-ccaagcagccgaagcccacccccaaatgatta
A0A8C0L5G0_BCL2L11      gttttatttactacttctcctcacaccctccccctccccacaattttttt
                        ** ** ** * ** **  **   ** **    **  *** *** *  ** 

A0A8C0L5G0_BCL2L11      tc-ttacgactgttacgttacatcgtccgcctggtgtggagattgca---
A0A8C0L5G0_BCL2L11      tctttaaggttactagtaaaaattccatacttattctggaaa-tgcaagg
                        ** *** *  *  **    * **      * *  * **** * ****   

A0A8C0L5G0_BCL2L11      ------------gtga
A0A8C0L5G0_BCL2L11      tattacctatatgtga
                                    ****

© 1998-2022Legal notice