Dataset for CDS BCL2L11 of organism Callorhinchus milii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W3IWD3_BCL2L11      --atgca---------------------------------------gtcg
A0A4W3IWD3_BCL2L11      --atgtgttcaggt--------------------------------gtcg
A0A4W3IWD3_BCL2L11      agatgcagtcagtttcagttccacacactgactgacaaaagagaaggtcg
                          ***                                         ****

A0A4W3IWD3_BCL2L11      tcaaggagtaccc-------------------------------------
A0A4W3IWD3_BCL2L11      tcaaggagtacccaggcatgtcacgaggtgagctttctgggcaaagcgat
A0A4W3IWD3_BCL2L11      tcaaggagtaccc-------------------------------agcgat

A0A4W3IWD3_BCL2L11      ----------------------agaatatccaattgtcaccggccttcat
A0A4W3IWD3_BCL2L11      ttccctattaacacgacatgcgagaatatccaattgtcaccggccttcat
A0A4W3IWD3_BCL2L11      ttccctattaacacgacatgcgagaatatccaattgtcaccggccttcat

A0A4W3IWD3_BCL2L11      tacaacttgcccattattcaatacgaatttttttcgtacaccatattccc
A0A4W3IWD3_BCL2L11      tacaacttgcccattattcaatacgaatttttttcgtacaccatattccc
A0A4W3IWD3_BCL2L11      tacaacttgcccattattcaatacgaatttttttcgtacaccatattccc

A0A4W3IWD3_BCL2L11      ctgtttccccatcttcgagaactagcaggttgtccagtggatattttact
A0A4W3IWD3_BCL2L11      ctgtttccccatcttcgagaactagcaggttgtccagtggatattttact
A0A4W3IWD3_BCL2L11      ctgtttccccatcttcgagaactagcaggttgtccagtggatattttact

A0A4W3IWD3_BCL2L11      tttgatgtggacatcggactgatggctagacccacgagttgcgacaagtc
A0A4W3IWD3_BCL2L11      tttgatgtggacatcggactgatggctagacccacgagttgcgacaagtc
A0A4W3IWD3_BCL2L11      tttgatgtggacatcggactgatggctagacccacgagttgcgacaagtc

A0A4W3IWD3_BCL2L11      tacgcagactccaagcccaacctgccaagccatctaccttgcacgtcaag
A0A4W3IWD3_BCL2L11      tacgcagactccaagcccaacctgccaagccatctaccttgcac------
A0A4W3IWD3_BCL2L11      tacgcagactccaagcccaacctgccaagccatctaccttgcacgtcaag

A0A4W3IWD3_BCL2L11      ctctggcacaggcaccgca--ttcacagactcatggtaagaatctccttc
A0A4W3IWD3_BCL2L11      ---------------------atcaca-------------------cttc
A0A4W3IWD3_BCL2L11      ctctggcacaggcaccattagatcaca-------------------cttc
                                              *****                   ****

A0A4W3IWD3_BCL2L11      tttgtattt-------------------ttcttccatcaatgactgcatt
A0A4W3IWD3_BCL2L11      tttatctctaatatcgacaaataaacagttcttaggt-aatcataatcgt
A0A4W3IWD3_BCL2L11      tttatctctaatgtcggtaaat------ttcttaggt-aatcataatcgt
                        *** * * *                   *****   * *** *      *

A0A4W3IWD3_BCL2L11      taacattgaattagacccccgaggt-----------------aaagg---
A0A4W3IWD3_BCL2L11      gaacttgaaatgatggttatgaggtatagtaaacagtgtgtgaaaggagt
A0A4W3IWD3_BCL2L11      gaacttgaaatgatggttatgaggtatagtaaacagtgtgtgaaaggagt
                         *** *  *** *       *****                 *****   

A0A4W3IWD3_BCL2L11      -----------------------------------ttttgttattg-tat
A0A4W3IWD3_BCL2L11      acatctgaaaagcacaccatttaattttccagttcttttgaaatcattat
A0A4W3IWD3_BCL2L11      acatctgaaaagcacaccatttaattttccagttcttttgaaatcattat
                                                           *****  **   ***

A0A4W3IWD3_BCL2L11      ga
A0A4W3IWD3_BCL2L11      ag
A0A4W3IWD3_BCL2L11      ag

© 1998-2022Legal notice