Dataset for CDS BMF of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7HZL0_BMF-01      atgccccgagcgggcgtattttggaaacaataccgcacggtgcggagtggcctcctcccg
F7HZL0_BMF-02      ------------------------------------------------------------
F7HZL0_BMF-03      ------------------------------------------------------------
                                                                               

F7HZL0_BMF-01      ccccggcccgcgtccgctgtcgccgccgccctttgcctgcgcctcccgcctcccgccgca
F7HZL0_BMF-02      ------------------------------------------------------------
F7HZL0_BMF-03      ------------------------------------------------------------
                                                                               

F7HZL0_BMF-01      gcccgctgggctttttccctccttcccaatcgagtctgggcatcaagcccccgagtgctc
F7HZL0_BMF-02      ------------------------------------------------------------
F7HZL0_BMF-03      ------------------------------------------------------------
                                                                               

F7HZL0_BMF-01      gtcacgctggaccctggcgcggagccctggcatcacgactcggaggccgagaccctctcc
F7HZL0_BMF-02      ------------------------------------------------------------
F7HZL0_BMF-03      ------------------------------------------------------------
                                                                               

F7HZL0_BMF-01      tggagtcacccaggggagatggagccatctcagtgtgtggaggagctggaggatgatgtg
F7HZL0_BMF-02      ------------------atggagccatctcagtgtgtggaggagctggaggatgatgtg
F7HZL0_BMF-03      ------------------atggagccatctcagtgtgtggaggagctggaggatgatgtg
                                     ******************************************

F7HZL0_BMF-01      ttccagccagaggatggggagccagggacccaacccgggagcttgctctctgctgaccta
F7HZL0_BMF-02      ttccagccagaggatggggagccagggacccaacccgggagcttgctctctgctgaccta
F7HZL0_BMF-03      ttccagccagaggatggggagccagggacccaacccgggagcttgctctctgctgaccta
                   ************************************************************

F7HZL0_BMF-01      tttgcccagagcctactggactgccccctcagtcggcttcagctcttccctctcacccac
F7HZL0_BMF-02      tttgcccagagcctactggactgccccctcagtcggcttcagctcttccctctcacccac
F7HZL0_BMF-03      tttgcccagagcctactggactgccccctcagtcggcttcagctcttccctctcacccac
                   ************************************************************

F7HZL0_BMF-01      tgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagc
F7HZL0_BMF-02      tgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagc
F7HZL0_BMF-03      tgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcagc
                   ************************************************************

F7HZL0_BMF-01      ccagcctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaaccccagcga
F7HZL0_BMF-02      ccagcctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaaccccagcga
F7HZL0_BMF-03      ccagcctcccccagccaaggtgtcatgctgccttgtggggtgactgaggaaccccagcga
                   ************************************************************

F7HZL0_BMF-01      ctcttttacggcaatgctggctaccggcttcctctccctgccagtttcccggcagtcttg
F7HZL0_BMF-02      ctcttttacggcaatgctggctaccggcttcctctccctgccagtttcccggcagtcttg
F7HZL0_BMF-03      ctcttttacggcaatgctggctaccggcttcctctccctgccagtttcccggcagtcttg
                   ************************************************************

F7HZL0_BMF-01      ccccttggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattgcc
F7HZL0_BMF-02      ccccttggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattgcc
F7HZL0_BMF-03      ccccttggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattgcc
                   ************************************************************

F7HZL0_BMF-01      cgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcag
F7HZL0_BMF-02      cgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaa---------
F7HZL0_BMF-03      cgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaa---ctgaat
                   ***************************************************         

F7HZL0_BMF-01      aaccgaaatcgcatgtggtggcaggtcctcctcttcc------------------tgcac
F7HZL0_BMF-02      ------------------------------------------------------------
F7HZL0_BMF-03      aaatggaggcctatagagattaggatgactttccttcagagacacaaccaagaaatgcca
                                                                               

F7HZL0_BMF-01      aacctggctttgaatggagaagagaacaggaatggggcaggccc----------------
F7HZL0_BMF-02      ------------------------------------------------------------
F7HZL0_BMF-03      agttgggccttgaatcca-aagacaagacgaaggagacaggattttgcatgggaggtgag
                                                                               

F7HZL0_BMF-01      ---gagcttccagccaggccagaagggcatgctctggaacccagcagga-tcacggctgc
F7HZL0_BMF-02      ---gaaactgaggcttg----------------gagaattgaagtaacacgcccaagtca
F7HZL0_BMF-03      agggagacaggggcttgggagggaggaaaagaagaggagtggagagggagtcccagctca
                      **       **  *                  * *    **    *  * *   *  

F7HZL0_BMF-01      ctctgc--------------acgtcttcccttccctccctgctgcggtgctcatggagag
F7HZL0_BMF-02      cacta----------------------------------taat------ttgctg-----
F7HZL0_BMF-03      ttccgctctgcctagagcaggcctcttttctgccttccctgac------ttcttgccacc
                     *                                    *          *  **     

F7HZL0_BMF-01      gatctaa
F7HZL0_BMF-02      ------a
F7HZL0_BMF-03      tctttaa
                         *

© 1998-2022Legal notice