Dataset for CDS BBC3 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8MW85_BBC3-03      aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgcccc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      cggggtgagtgtgcgcgccctgaatcctcgccggcggcgatcggccaggc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      cgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtgc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      gggcgccctgcctccccacactgcgcctccccacaaaccccacgagggac
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      cctgggctggggtcgcggggagggaggcggctcggcgttggggcgcctgg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      tctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaacaat
A0A2R8MW85_BBC3-02      ------------------------------------------------at
                                                                        **

A0A2R8MW85_BBC3-03      ggggtgcgggctcggcagcgccccctggcggccagtgcgaccccggggaa
A0A2R8MW85_BBC3-02      gaaatgtgg-----------------------------------------
                        *   ** **                                         

A0A2R8MW85_BBC3-03      gagggtcgaccccggggtgccccagcccccaaagtcagggaggggcgggg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      gggcggcacggaggggcggccacacccagggcgcgcgcccgctgggggcg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      gcgacagggggcggctcgcgggccgtggagtctgcggctcctgcgggcgg
A0A2R8MW85_BBC3-02      -----------------------cgtggggtctgc---------------
                                               ***** ******               

A0A2R8MW85_BBC3-03      gggctgcgccccagcaacagccggttattggccccgcgctcgcctggcgg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      gcggggcgggcgcacgtggcggcggtgggggtggctgtgacagcggagtg
A0A2R8MW85_BBC3-02      ------------------------ctgggcatgtccatgcca----agtg
                                                 ****  ** *  ** **    ****

A0A2R8MW85_BBC3-03      gggcgtctgggaccgccgtgggagcgcgcgtgtgcggggttgtggatctg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      caggtgtctcgcctgggccccagggagcgccatggcccgcgcacgccagg
A0A2R8MW85_BBC3-02      ------------------cccaggg-------------------------
                                          *******                         

A0A2R8MW85_BBC3-03      agggcagctccccggagcccgtagagggcttggcccgcgacggcccgcgc
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      cccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctg
A0A2R8MW85_BBC3-02      --cttcttcctcgg------------------------------------
                          ****   ** **                                    

A0A2R8MW85_BBC3-03      cgagtccggcctgcccgccacccccgccgcccccgccttgctgcccgctg
A0A2R8MW85_BBC3-02      --------------------------------------------------
                                                                          

A0A2R8MW85_BBC3-03      cctacctctgcgcccccgccgccccacccgccgtcaccgccgccctgggg
A0A2R8MW85_BBC3-02      ---------------------------------------------tgtgg
                                                                     ** **

A0A2R8MW85_BBC3-03      ggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgccc
A0A2R8MW85_BBC3-02      gtcccctgccag------------------------------------at
                        * **** **  *                                      

A0A2R8MW85_BBC3-03      ggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgc
A0A2R8MW85_BBC3-02      gtgtggtcctcagccctcgctctcgctggcggagcagcacctggagtcgc
                        *   **********************************************

A0A2R8MW85_BBC3-03      ccgtgcccagcgccccaggggccctggcgggcggtcccacccaggcggcc
A0A2R8MW85_BBC3-02      ccgtgcccagcgccccaggggccctggcgggcggtcccacccaggcggcc
                        **************************************************

A0A2R8MW85_BBC3-03      cccggagtccgcggggaggaggagcagtgggcccgggagatcggggccca
A0A2R8MW85_BBC3-02      cccggagtccgcggggaggaggagcagtgggcccgggagatcggggccca
                        **************************************************

A0A2R8MW85_BBC3-03      gctgcgacggatggcggacgacctcaacgcgctgtacgagcggcggagac
A0A2R8MW85_BBC3-02      gctgcgacggatggcggacgacctcaacgcgctgtacgagcggcggagac
                        **************************************************

A0A2R8MW85_BBC3-03      aagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat
A0A2R8MW85_BBC3-02      aagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat
                        **************************************************

A0A2R8MW85_BBC3-03      ctcatcatgggactcctgccctttcccaggggccacagagccccggagat
A0A2R8MW85_BBC3-02      ctcatcatgggactcctgccctttcccaggggccacagagccccggagat
                        **************************************************

A0A2R8MW85_BBC3-03      ggagcccaattag
A0A2R8MW85_BBC3-02      ggagcccaattag
                        *************

© 1998-2020Legal notice