Dataset for CDS BBC3 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R8MW85_BBC3-03      aggaagccgcccgccctccaccgccgccccctccggcgtgttcatgcccc
A0A2R8MW85_BBC3-01      atgaa---------------------------------------------
A0A2R8MW85_BBC3-02      atgaa---------------------------------------------
                        * ***                                             

A0A2R8MW85_BBC3-03      cggggtgagtgtgcgcgccctgaatcctcgccggcggcgatcggccaggc
A0A2R8MW85_BBC3-01      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      cgggtgggctccctggaggaggtgacaggagtgcaggcggcgagcagtgc
A0A2R8MW85_BBC3-01      ----------------------------------atgtggcg--------
A0A2R8MW85_BBC3-02      ----------------------------------atgtggcg--------
                                                          * * ****        

A0A2R8MW85_BBC3-03      gggcgccctgcctccccacactgcgcctccccacaaaccccacgagggac
A0A2R8MW85_BBC3-01      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      cctgggctggggtcgcggggagggaggcggctcggcgttggggcgcctgg
A0A2R8MW85_BBC3-01      -------tggggtc------------------------------------
A0A2R8MW85_BBC3-02      -------tggggtc------------------------------------

A0A2R8MW85_BBC3-03      tctgggcgcacaggtgcctcggcggtctggcgggtttgtttacaaacaat
A0A2R8MW85_BBC3-01      --------------tgcct-------------------------------
A0A2R8MW85_BBC3-02      --------------tgcct-------------------------------

A0A2R8MW85_BBC3-03      ggggtgcgggctcggcagcgccccctggcggccagtgcgaccccggggaa
A0A2R8MW85_BBC3-01      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      gagggtcgaccccggggtgccccagcccccaaagtcagggaggggcgggg
A0A2R8MW85_BBC3-01      --------------------------------------------------
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      gggcggcacggaggggcggccacacccagggcgcgcgcccgctgggggcg
A0A2R8MW85_BBC3-01      -----------------gggcatgtccatgccaagtgccc----------
A0A2R8MW85_BBC3-02      -----------------gggcatgtccatgccaagtgccc----------
                                         ** **   *** * *  * ****          

A0A2R8MW85_BBC3-03      gcgacagggggcggctcgcgggccgtggagtctgcggctcctgcgggcgg
A0A2R8MW85_BBC3-01      -------------------------------------------------a
A0A2R8MW85_BBC3-02      -------------------------------------------------a

A0A2R8MW85_BBC3-03      gggctgcgccccagcaacagccggttattggccccgcgctcgcctggcgg
A0A2R8MW85_BBC3-01      gggcttcttcct--------------------------------------
A0A2R8MW85_BBC3-02      gggcttcttcct--------------------------------------
                        ***** *  **                                       

A0A2R8MW85_BBC3-03      gcggggcgggcgcacgtggcggcggtgggggtggctgtgacagcggagtg
A0A2R8MW85_BBC3-01      -------------------------------------------cggtgtg
A0A2R8MW85_BBC3-02      -------------------------------------------cggtgtg
                                                                   *** ***

A0A2R8MW85_BBC3-03      gggcgtctgggaccgccgtgggagcgcgcgtgtgcggggttgtggatctg
A0A2R8MW85_BBC3-01      ggtcccctg----------------------------------------c
A0A2R8MW85_BBC3-02      ggtcccctg----------------------------------------c
                        ** *  ***                                         

A0A2R8MW85_BBC3-03      caggtgtctcgcctgggccccagggagcgccatggcccgcgcacgccagg
A0A2R8MW85_BBC3-01      cagatgtgt------ggccccagggagcgccatggcccgcgcacgccagg
A0A2R8MW85_BBC3-02      cagatgtgt-----------------------------------------
                        *** *** *                                         

A0A2R8MW85_BBC3-03      agggcagctccccggagcccgtagagggcttggcccgcgacggcccgcgc
A0A2R8MW85_BBC3-01      agggcagctccccggagcccgtagagggcttggcccgcgacggcccgcgc
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      cccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctg
A0A2R8MW85_BBC3-01      cccttcccgcttggccgcctggtgccctcggccgtgtcctgcggcctctg
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      cgagtccggcctgcccgccacccccgccgcccccgccttgctgcccgctg
A0A2R8MW85_BBC3-01      cgagtccggcctgcccgccacccccgccgcccccgccttgctgcccgctg
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      cctacctctgcgcccccgccgccccacccgccgtcaccgccgccctgggg
A0A2R8MW85_BBC3-01      cctacctctgcgcccccgccgccccacccgccgtcaccgccgccctgggg
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      ggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgccc
A0A2R8MW85_BBC3-01      ggcccccgctggcctgggggcccccgcagccgcccccgaggcccgcgccc
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      ggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgc
A0A2R8MW85_BBC3-01      ggacggtcctcagccctcgctctcgctggcggagcagcacctggagtcgc
A0A2R8MW85_BBC3-02      ----ggtcctcagccctcgctctcgctggcggagcagcacctggagtcgc

A0A2R8MW85_BBC3-03      ccgtgcccagcgccccaggggccctggcgggcggtcccacccaggcggcc
A0A2R8MW85_BBC3-01      ccgtgcccagcgccccaggggccctggcgggcggtcccacccaggcggcc
A0A2R8MW85_BBC3-02      ccgtgcccagcgccccaggggccctggcgggcggtcccacccaggcggcc

A0A2R8MW85_BBC3-03      cccggagtccgcggggaggaggagcagtgggcccgggagatcggggccca
A0A2R8MW85_BBC3-01      cccggagtccgcggggaggaggagcagtgggcccgggagatcggggccca
A0A2R8MW85_BBC3-02      cccggagtccgcggggaggaggagcagtgggcccgggagatcggggccca

A0A2R8MW85_BBC3-03      gctgcgacggatggcggacgacctcaacgcgctgtacgagcggcggagac
A0A2R8MW85_BBC3-01      gctgcgacggatggcggacgacctcaacgcgctgtacgagcggcggagac
A0A2R8MW85_BBC3-02      gctgcgacggatggcggacgacctcaacgcgctgtacgagcggcggagac

A0A2R8MW85_BBC3-03      aagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat
A0A2R8MW85_BBC3-01      aagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat
A0A2R8MW85_BBC3-02      aagaggagcagccgcagcaccgcccctcgccctggagggtcctgtacaat

A0A2R8MW85_BBC3-03      ctcatcatgggactcctgccctttcccaggggccacagagccccggagat
A0A2R8MW85_BBC3-01      ctcatcatgggactcctgccctttcccaggggccacagagccccggagat
A0A2R8MW85_BBC3-02      ctcatcatgggactcctgccctttcccaggggccacagagccccggagat

A0A2R8MW85_BBC3-03      ggagcccaattag-------------------------------------
A0A2R8MW85_BBC3-01      ggagcccaattaggtgcctgcacccgcccggtggacgtcagggacttggg
A0A2R8MW85_BBC3-02      ggagcccaattag-------------------------------------

A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      gggcaggcccctcccatctcctgacaccctggccagcgcgggggactttc
A0A2R8MW85_BBC3-02      --------------------------------------------------

A0A2R8MW85_BBC3-03      --------------
A0A2R8MW85_BBC3-01      tctgcaccatgtag
A0A2R8MW85_BBC3-02      --------------

© 1998-2021Legal notice