Dataset for CDS BMF of organism Calidris pygmaea

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3KIN9_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C3KIN9_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct
                       **************************************************

A0A8C3KIN9_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C3KIN9_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                       **************************************************

A0A8C3KIN9_BMF-01      gtgagatgactgcaactggcattttcacacagaaccagtcgtacagctgc
A0A8C3KIN9_BMF-02      gtgagatgactgcaactggcattttcacacagaaccagtcgtacagctgc
                       **************************************************

A0A8C3KIN9_BMF-01      cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
A0A8C3KIN9_BMF-02      cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
                       **************************************************

A0A8C3KIN9_BMF-01      tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A8C3KIN9_BMF-02      tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
                       **************************************************

A0A8C3KIN9_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C3KIN9_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                       **************************************************

A0A8C3KIN9_BMF-01      cggagactcttctatgggaatgctggttaccgtttacatgtccctccggt
A0A8C3KIN9_BMF-02      cggagactcttctatgggaatgctggttaccgtttacatgtccctccggt
                       **************************************************

A0A8C3KIN9_BMF-01      tggctttgcattggatccgcacctccaagaggagcctcaggaaggtcagc
A0A8C3KIN9_BMF-02      tggctttgcattggatccgcacctccaagaggagcctcaggaaggtcagc
                       **************************************************

A0A8C3KIN9_BMF-01      gggaagcacgtgccgaggtgcagatcgcacggaagttgcagtgcattgcc
A0A8C3KIN9_BMF-02      gggaagcacgtgccgaggtgcagatcgcacggaagttgcagtgcattgcc
                       **************************************************

A0A8C3KIN9_BMF-01      gaccagttccaccggctccacatacagaggcatcagcagaacagaaatca
A0A8C3KIN9_BMF-02      gaccagttccaccggctccacatacagagg-----gtagggtgtctctgg
                       ******************************     * **        *  

A0A8C3KIN9_BMF-01      agtgtggtggcagctttttctcttcctacacaacttggccttaaacgcgg
A0A8C3KIN9_BMF-02      ag-gggatggtgggggtttagctctccaggagtggtgctctggaagacca
                       ** * * ***  *   ***  **  * *       **  **  **  *  

A0A8C3KIN9_BMF-01      aggcgaacaggaacca-----------cactg-----ggcagagg--tga
A0A8C3KIN9_BMF-02      gatc---caggcatcagctaagcaggccgctgtctaaggcagcagactaa
                          *   **** * **           * ***     *****  *  * *

© 1998-2022Legal notice