Dataset for CDS egl-1 of organism Caenorhabditis remanei

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

E3LTJ5_EGL1-01      atgctcacattcgcctcatcctcctcatcggaccttttcctctcgatgcccaattcccac
E3M1A5_EGL1-01      atgcttacattcg------cctcctcttcggaccttcttatttcgatgccttcatcacac
E3MP30_EGL1-01      ---------------------------------------------atgctttcattactc
                                                                 ****     *  * *

E3LTJ5_EGL1-01      ttcgacattgtcaaacccttctgctgtatcaacgaaaaaaagattatgtgctccgactac
E3M1A5_EGL1-01      tatgacttcgtcaaacccttctattccaa------caagaacatgctgttctccgatttc
E3MP30_EGL1-01      tgtgacttcgtcaaacccttctactccaacaacttcaagaacatgatgtttttcgacttc
                    *  *** * *************  *  *        ** ** **  ***  * *** * *

E3LTJ5_EGL1-01      tgtaacacgtcttctgatgacgcctctacatcttctgagttcgctgatgattctggattt
E3M1A5_EGL1-01      c---ccacgtcttctgatcatgccgtcacgtcttctgaattcgctgacgattctgaattt
E3MP30_EGL1-01      c---acacgtcttctcttcatgccgtgacgtcttctgagttcgctgaagattctggattt
                         **********  * * ***   ** ******** ******** ******* ****

E3LTJ5_EGL1-01      ttcgatgactccgaaaccgacgactacatcaccaaaaccgcgtatgaaatcggcacaaaa
E3M1A5_EGL1-01      tttgattcctccgaaaccagccattacattcacgagattagccaggaaatcggcaccaaa
E3MP30_EGL1-01      ttagattcctccaaaaccagtcactacattcacgagagaagtaaggaaatcggcaccaag
                    ** ***  **** *****    * *****   * * *      * *********** ** 

E3LTJ5_EGL1-01      ctcgttgcgatgtgtgatgacttcgatgcccaaatgatgtcatactccagaacagtac--
E3M1A5_EGL1-01      ttggctgcaatgtgcgatgacttcgatgccaaaatgatgtcatactccagaagtggatcc
E3MP30_EGL1-01      ttgactacaatgtgcgatggcttcgatgccaaaatgatgtcatactcaagaagtgaatct
                     *   * * ***** **** ********** **************** ****  * *   

E3LTJ5_EGL1-01      -cctccagaagtattctcagtcgtgttttcgacttcttcgccttctag
E3M1A5_EGL1-01      acttccagaagtcttctcggacgcttcctcgacttcttcgccttctga
E3MP30_EGL1-01      acctccagaagtcttctcgggcgtttttacgacttctttgccttctga
                     * ********* ***** * **  *   ********* *******  

© 1998-2022Legal notice