Dataset for CDS classical BH3-containing proteins of organism Bubo bubo

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0FLD7_BCL2L11      atgcac--------------------------atcttgcgcgac------
A0A8C0EIQ9_PMAIP1-      ---------ccctccggcct------------ttcttgcccaaa------
A0A8C0EML4_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
                                                         *** **           

A0A8C0FLD7_BCL2L11      --------------------------------------------------
A0A8C0EIQ9_PMAIP1-      --------------------------------------------------
A0A8C0EML4_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                                                                          

A0A8C0FLD7_BCL2L11      --------------------------------------------------
A0A8C0EIQ9_PMAIP1-      --------------------------------------------------
A0A8C0EML4_BMF-01       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
                                                                          

A0A8C0FLD7_BCL2L11      ---------aagtcccatttgtgctgcataccatgtg-------------
A0A8C0EIQ9_PMAIP1-      -------ggagg--------------------------------------
A0A8C0EML4_BMF-01       cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
                                 * *                                      

A0A8C0FLD7_BCL2L11      ----------------------------------caggccctgagtattt
A0A8C0EIQ9_PMAIP1-      ----------------------------------caaaccccagccccca
A0A8C0EML4_BMF-01       tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
                                                          **  * *         

A0A8C0FLD7_BCL2L11      atttttttgttgttgttcctctgtttca----------------------
A0A8C0EIQ9_PMAIP1-      cctctcccgg----------------------------------------
A0A8C0EML4_BMF-01       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                          * *                                             

A0A8C0FLD7_BCL2L11      ----------------------------actgctctggttttgttccgtg
A0A8C0EIQ9_PMAIP1-      --------------------------------------------------
A0A8C0EML4_BMF-01       cggagactcttctatggcaatgctggttaccgtttacatgtccctccagt
                                                                          

A0A8C0FLD7_BCL2L11      cagcttcccggtggcagtctcactcgctagcaga----------------
A0A8C0EIQ9_PMAIP1-      ---------------------accaccgcg--------------------
A0A8C0EML4_BMF-01       tggctttgcgttgg-atccgcacctccaagaggagcctcgggaaggtcag
                                             **   *  *                    

A0A8C0FLD7_BCL2L11      --agacgtacagcccgaaatctggattgcacaggagctgcggcgcattgg
A0A8C0EIQ9_PMAIP1-      ----------gtggcggagtgc-----gccctgcagctgcgcaggatagg
A0A8C0EML4_BMF-01       cgggaagcacgtgccgaggtgcagattgcacggaagttgcagtgcattgc
                                      **   *       ** * * ** ***   * ** * 

A0A8C0FLD7_BCL2L11      agatgagttcaatgcctcctat----------------------------
A0A8C0EIQ9_PMAIP1-      cgacaagtgggacc------------------------------------
A0A8C0EML4_BMF-01       cgaccagttccaccggctccacatacagaggcatcagcagaacagaaatc
                         **  ***   *                                      

A0A8C0FLD7_BCL2L11      ---tgtccaagaagggtaactttcatctttttactttccatttctttaca
A0A8C0EIQ9_PMAIP1-      ---tgcggcagaag------------atcctgaacctcc-------t-ca
A0A8C0EML4_BMF-01       aagtgtggtggcag------------ctttttctcttcc-------taca
                           **     * **             *  *     ***       * **

A0A8C0FLD7_BCL2L11      taggggcccgctgcctgcgccagcg------agtcacctgctgctgcagc
A0A8C0EIQ9_PMAIP1-      caa----------------------------agctgttctgcccggaaac
A0A8C0EML4_BMF-01       caacttggccttaaatgcggaggcgaacaggaaccacactgggcagag--
                         *                             *           * *    

A0A8C0FLD7_BCL2L11      gtccttaa
A0A8C0EIQ9_PMAIP1-      g----tga
A0A8C0EML4_BMF-01       g----tga
                        *    * *

© 1998-2022Legal notice