Dataset for CDS classical BH3-containing proteins of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B1K1X5_BMF-01       atg-------------------------------------------gacg
A0A3B1JXK6_BCL2L11      atg-----tccagaccgtcaaaccgggccacccgcccacccttcttaaag
A0A3B1IH05_BAD-01       atg-----tccacagcggcgag------------------------agcg
A0A3B1JLM2_BAD-01       atgagcaatcagtatctgctaa------------------------aact

A0A3B1K1X5_BMF-01       atgaggaggatgatgtgttcgttacgg-----------------------
A0A3B1JXK6_BCL2L11      gagcaggg-------ggaacgcggccagagcggcggggg-----------
A0A3B1IH05_BAD-01       gcggcggg-------gacctgcgac-------------------------
A0A3B1JLM2_BAD-01       gaggagagctcgttttaattgcgacgaggagggatatagccaagcactta
                          *  * *            *   *                         

A0A3B1K1X5_BMF-01       -atccagagccttggcgttccccgatcagtgtgataaagcaggaggagcg
A0A3B1JXK6_BCL2L11      -cggcggaacattgtcccgagccgagcagtgcgagcagcctg--agcccg
A0A3B1IH05_BAD-01       -----------tccactg---------------------ctgtcagccag
A0A3B1JLM2_BAD-01       acagcagaacatcgactgaaggaggggggagagatacgcttttcaggcca
                                   *   *                             *    

A0A3B1K1X5_BMF-01       tggcac------------------acagactccagggcgg----------
A0A3B1JXK6_BCL2L11      ---------------------------------gcgatgg----------
A0A3B1IH05_BAD-01       ccgtcc--aaactc-------------gatttcacaatgg----------
A0A3B1JLM2_BAD-01       ttgtgctggaattcatctggaagcacagttttcacaatggaaaagacacc

A0A3B1K1X5_BMF-01       -ccgccggctcggaccaatggcatgctgccctgcggaatatccgaggagc
A0A3B1JXK6_BCL2L11      -cgacccggttaggg---------gaccccctgcgctgcacaatagcctt
A0A3B1IH05_BAD-01       atcacat-gttcacaatatctgatgagtc----agatgcatctgaagagc
A0A3B1JLM2_BAD-01       accacacagtaaagaagatgacatcagtcccatagatgaccacgatgaat
                            *    *                  *     *         *     

A0A3B1K1X5_BMF-01       caagacgcc-----tcttctacggtagtgcaggactgttatta-------
A0A3B1JXK6_BCL2L11      ctcggttaccagacccggtcgccgctgttccgaactctctccaggtcctc
A0A3B1IH05_BAD-01       taggagactcaga-ccagccagaggt---------------ca-------
A0A3B1JLM2_BAD-01       caaggtggtcagaggcagtcaagagtgtc---gactccccaca-------
                           *           *                          *       

A0A3B1K1X5_BMF-01       -----------------ctggca------ccgtctgcccgttctgaacgc
A0A3B1JXK6_BCL2L11      gagtggatatttctcgttcgacagcgagcccagctccccgctcctgatgc
A0A3B1IH05_BAD-01       ---------------gtaagacagctgagccatc------------gcgg
A0A3B1JLM2_BAD-01       ---------------gacggacagcgggcccagc------------atgt
                                           * **      **  *              * 

A0A3B1K1X5_BMF-01       gtcggg--------------------------------------------
A0A3B1JXK6_BCL2L11      acagcgcgtccactca----------------------------------
A0A3B1IH05_BAD-01       tctgggcagcacatca---------ctgttccggaga-------------
A0A3B1JLM2_BAD-01       acaggg--acacatcatcagacgagctgtt--ggaggtggggggtcgagt
                           * *                                            

A0A3B1K1X5_BMF-01       -------gacg--------------ccatgt-------------------
A0A3B1JXK6_BCL2L11      -------gaccccgagtccatctagccaagtcataattcacgcccttcag
A0A3B1IH05_BAD-01       -------aactcagagtagagc---ccaggc----aaaggaatttttcta
A0A3B1JLM2_BAD-01       gaggctctactcagagt----c---ccaagt----gtacaa---catcaa
                                **               *** *                    

A0A3B1K1X5_BMF-01       --------------------ttcggga----ggagcatcgagcc------
A0A3B1JXK6_BCL2L11      cgcat-------ttccgaggcgcgagg---cgacgctcagagtttcga--
A0A3B1IH05_BAD-01       tgaatgaagaggctctg-----caggagtctggtgctgggagacacgaag
A0A3B1JLM2_BAD-01       ccgctgggaggacaatgagaaccagga---tggcgcttcagcagaggacg
                                              *  *     *  **              

A0A3B1K1X5_BMF-01       gttgagcc----------------tcggcggcggccggcgcacagc----
A0A3B1JXK6_BCL2L11      gttatgtccaggacctaa-------ccactgtccaccccacagagcagcg
A0A3B1IH05_BAD-01       atggagctcgagatggagattcattccgacgccgcagccgctcagctccc
A0A3B1JLM2_BAD-01       gtggtgtcggtgacggagcaccattccgaggccgatcccagtcagctcct
                         *   *                   *    *       *    ***    

A0A3B1K1X5_BMF-01       --------gtggaggccc----gtatcgga--------cagaagctccag
A0A3B1JXK6_BCL2L11      gctgcg--ggggacatgcaagcgcattggtacatcgcgcaagagttgcga
A0A3B1IH05_BAD-01       ccttctctgtgggcagccaagaaatatggc--------cgacagctgagg
A0A3B1JLM2_BAD-01       gctgcgctatggaaagccaagaaatatgga--------cggcagttgagg
                                  **     *         **         *   ** *    

A0A3B1K1X5_BMF-01       atgatcggagaccagtttta----------------------tcaagagc
A0A3B1JXK6_BCL2L11      cgcattggggatgaattcaacgatctgtacttccgaggggcaggcagaaa
A0A3B1IH05_BAD-01       aagatgagtgacgagtttgacaaggggctagagcaaggga--tgaagagg
A0A3B1JLM2_BAD-01       aggatgagcgatgagtttgacacctggttggacaaaggggacttaaga--
                           **  * **  * **  *                         ***  

A0A3B1K1X5_BMF-01       acatgctgcaacacagaaacc------aaaggaaccagcag--ccgcttt
A0A3B1JXK6_BCL2L11      tggaggtggtgcccaacttcctgcacaaaatgaacccgccttcatactgt
A0A3B1IH05_BAD-01       gtgaggagtgccggagcagcccgcc---agat-----gcaaaactccccc
A0A3B1JLM2_BAD-01       ------------agaacaactggccctgggag-----gcataccaaccga
                                      *    *                 **       *   

A0A3B1K1X5_BMF-01       ggttg---cgcttggcgtcggcgctctacacgctcctgttcgagagggag
A0A3B1JXK6_BCL2L11      ggatggggctcctgattgaacgtctccgacagttcctccacagaag----
A0A3B1IH05_BAD-01       agctggtttgcctttctttggagtcacaaggaatcagactctgaggcgag
A0A3B1JLM2_BAD-01       ggatggttctctttcctctggggtaccaaagaa---------gaggaggg
                         * **     * *                                *    

A0A3B1K1X5_BMF-01       ccggcggctcacgggaggcgagaggaccggaggtga
A0A3B1JXK6_BCL2L11      ---------------aa--------------gatga
A0A3B1IH05_BAD-01       cagcagccgtccagcag--------------aatga
A0A3B1JLM2_BAD-01       aag------------ag--------------aataa
                                       *                 * *

© 1998-2020Legal notice