Dataset for CDS classical BH3-containing proteins of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1K1X5_BMF-01       atg-----------------------------------------------
A0A8B9LSW6_BMF-02       atg-----------------------------------------------
A0A8B9LSW6_BMF-01       atg-----------------------------------------------
A0A3B1JXK6_BCL2L11      atgtccagaccgtcaaaccgggccacccgcccacccttcttaaaggagca
A0A8B9HBP0_BCL2L11      ----------------------gctctcggtctc----------------
A0A3B1JLM2_BAD-01       atgagcaatcagt-------------------------------------
A0A8B9KQD8_BAD-01       atgagcaatcagt-------------------------------------
A0A3B1IH05_BAD-01       atg-----tccac-------------------------------------
A0A8B9JSR5_BAD-01       atg-----tccac-------------------------------------
                                                                          

A0A3B1K1X5_BMF-01       -------gacgatgaggaggatgatgtgttcgttacggatcc--------
A0A8B9LSW6_BMF-02       -------gacgatgaggaggatgatgtgttcgttacggatcc--------
A0A8B9LSW6_BMF-01       -------gacgatgaggaggatgatgtgttcgttacggatcc--------
A0A3B1JXK6_BCL2L11      gggggaacgcggccagagcggcgggg--------------gcggc-----
A0A8B9HBP0_BCL2L11      -------cggggttgtgacggcgggg--------------gcggc-----
A0A3B1JLM2_BAD-01       -------atctgctaaaactgaggagagctcgttttaattgcgacgagga
A0A8B9KQD8_BAD-01       -------atctgctaaaactgaggagagctcgttttaattgcgacgagga
A0A3B1IH05_BAD-01       -------agcggcgagagcggcggcggg-------gacctgcgac-----
A0A8B9JSR5_BAD-01       -------agcggcgagagcggcggcggg-------gacctgcgac-----
                                              *  *               *        

A0A3B1K1X5_BMF-01       -------------------------agagccttggcgttccccgatcagt
A0A8B9LSW6_BMF-02       -------------------------agagccttggcgttccccgatcagt
A0A8B9LSW6_BMF-01       -------------------------agagccttggcgttccccgatcagt
A0A3B1JXK6_BCL2L11      -------------------------ggaacattgtcccgagccgagcagt
A0A8B9HBP0_BCL2L11      -------------------------ggaacattgtcccgagccgagcagt
A0A3B1JLM2_BAD-01       gggatatagccaagcacttaacagcagaacatcgactgaaggagggggga
A0A8B9KQD8_BAD-01       gggatatagccaagcacttaacagcagaacatcgactgaaggagggggga
A0A3B1IH05_BAD-01       -------------------------------tccactg------------
A0A8B9JSR5_BAD-01       -------------------------------tccactg------------
                                                       *   *              

A0A3B1K1X5_BMF-01       gtgataaagcaggaggagcgtggcac------------------acagac
A0A8B9LSW6_BMF-02       gtgataaagcaggaggagcgtggcac------------------acagac
A0A8B9LSW6_BMF-01       gtgataaagcaggaggagcgtggcac------------------acagac
A0A3B1JXK6_BCL2L11      gcgagcagcctg--agcccg------------------------------
A0A8B9HBP0_BCL2L11      gcgagcagcctg--agcccg------------------------------
A0A3B1JLM2_BAD-01       gagatacgcttttcaggccattgtgctggaattcatctggaagcacagtt
A0A8B9KQD8_BAD-01       gagatacgcttttcaggccattgtgctggaattcatctggaagcacagtt
A0A3B1IH05_BAD-01       ---------ctgtcagccagccgtcc--aaactc-------------gat
A0A8B9JSR5_BAD-01       ---------ctgtcagccagccgtcc--aaactc-------------gat
                                       *                                  

A0A3B1K1X5_BMF-01       tccagggcgg-----------ccgccggctcggaccaatggcatgctgcc
A0A8B9LSW6_BMF-02       tccagggcgg-----------ccgccggctcggaccaatggcatgctgcc
A0A8B9LSW6_BMF-01       tccagggcgg-----------ccgccggctcggaccaatggcatgctgcc
A0A3B1JXK6_BCL2L11      ---gcgatgg-----------cgacccggttaggg---------gacccc
A0A8B9HBP0_BCL2L11      ---gcgatgg-----------cgacccggttaggg---------gacccc
A0A3B1JLM2_BAD-01       ttcacaatggaaaagacaccaccacacagtaaagaagatgacatcagtcc
A0A8B9KQD8_BAD-01       ttcacaatggaaaagacaccaccacacagtaaagaagatgacatcagtcc
A0A3B1IH05_BAD-01       ttcacaatgg----------atcacat-gttcacaatatctgatgagtc-
A0A8B9JSR5_BAD-01       ttcacaatgg----------atcacat-gttcacaatatctgatgagtc-
                                **              *    *                  * 

A0A3B1K1X5_BMF-01       ctgcggaatatccgaggagccaagacgcc-----tcttctacggtagtgc
A0A8B9LSW6_BMF-02       ctgcggaatatccgaggagccaagacgcc-----tcttctacggtagtgc
A0A8B9LSW6_BMF-01       ctgcggaatatccgaggagccaagacgcc-----tcttctacggtagtgc
A0A3B1JXK6_BCL2L11      ctgcgctgcacaatagccttctcggttaccagacccggtcgccgctgttc
A0A8B9HBP0_BCL2L11      ctgcgctgcacaatagccttctcggttaccagacccggtcgccgctgttc
A0A3B1JLM2_BAD-01       catagatgaccacgatgaatcaaggtggtcagaggcagtcaagagtgtc-
A0A8B9KQD8_BAD-01       catagatgaccacgatgaatcaaggtggtcagaggcagtcaagagtgtc-
A0A3B1IH05_BAD-01       ---agatgcatctgaagagctaggagactcaga-ccagccagaggt----
A0A8B9JSR5_BAD-01       ---agatgcatctgaagagctaggagactcaga-ccagccagaggt----
                            *         *        *           *              

A0A3B1K1X5_BMF-01       aggactgttatta------------------------ctggca------c
A0A8B9LSW6_BMF-02       aggactgttatta------------------------ctggca------c
A0A8B9LSW6_BMF-01       aggactgttatta------------------------ctggca------c
A0A3B1JXK6_BCL2L11      cgaactctctccaggtcctcgagtggatatttctcgttcgacagcgagcc
A0A8B9HBP0_BCL2L11      cgaactctctccaggtcctcgagtggatatttctcgttcgacagcgagcc
A0A3B1JLM2_BAD-01       --gactccccaca----------------------gacggacagcgggcc
A0A8B9KQD8_BAD-01       --gactccccaca----------------------gacggacagcgggcc
A0A3B1IH05_BAD-01       -----------ca----------------------gtaagacagctgagc
A0A8B9JSR5_BAD-01       -----------ca----------------------gtaagacagctgagc
                                    *                          * **      *

A0A3B1K1X5_BMF-01       cgtctgcccgttctgaacgcgtcggg------------------------
A0A8B9LSW6_BMF-02       cgtctgcccgttctgaacgcgtcggg------------------------
A0A8B9LSW6_BMF-01       cgtctgcccgttctgaacgcgtcggg------------------------
A0A3B1JXK6_BCL2L11      cagctccccgctcctgatgcacagcgcgtccactca--------------
A0A8B9HBP0_BCL2L11      cagctccccgctcctgatgcacagcgcgtccactca--------------
A0A3B1JLM2_BAD-01       cagc------------atgtacaggg--acacatcatcagacgagctgtt
A0A8B9KQD8_BAD-01       cagc------------atgtacaggg--acacatcatcagacgagctgtt
A0A3B1IH05_BAD-01       catc------------gcggtctgggcagcacatca---------ctgtt
A0A8B9JSR5_BAD-01       catc------------gcggtctgggcagcacatca---------ctgtt
                        *  *              *    * *                        

A0A3B1K1X5_BMF-01       ---------------------------gacg--------------ccatg
A0A8B9LSW6_BMF-02       ---------------------------gacg--------------ccatg
A0A8B9LSW6_BMF-01       ---------------------------gacg--------------ccatg
A0A3B1JXK6_BCL2L11      ---------------------------gaccccgagtccatctagccaag
A0A8B9HBP0_BCL2L11      ---------------------------gaccccgagtccatctagccaag
A0A3B1JLM2_BAD-01       --ggaggtggggggtcgagtgaggctctactcagagt----c---ccaag
A0A8B9KQD8_BAD-01       --ggaggtggggggtcgagtgaggctctactcagagt----c---ccaag
A0A3B1IH05_BAD-01       ccggaga--------------------aactcagagtagagc---ccagg
A0A8B9JSR5_BAD-01       ccggaga--------------------aactcagagtagagc---ccagg
                                                    **               *** *

A0A3B1K1X5_BMF-01       t-----------------------------------ttcggga----gga
A0A8B9LSW6_BMF-02       t-----------------------------------ttcggga----gga
A0A8B9LSW6_BMF-01       t-----------------------------------ttcggga----gga
A0A3B1JXK6_BCL2L11      t---cataattcacgcccttcagcgcatttccgaggcgcgagg---cgac
A0A8B9HBP0_BCL2L11      t---cataattcacgcccttcagcgcatttccgaggcgcgagg---cgac
A0A3B1JLM2_BAD-01       tgtacaacatcaaccgctgggaggacaatgagaac---cagga---tggc
A0A8B9KQD8_BAD-01       tgtacaacatcaaccgctgggaggacaatgagaac---cagga---tggc
A0A3B1IH05_BAD-01       c-----aaaggaatttttctatgaatgaagaggctctgcaggagtctggt
A0A8B9JSR5_BAD-01       c-----aaaggaatttttctatgaatgaagaggatctgcaggagtctggt
                                                              *  *     *  

A0A3B1K1X5_BMF-01       gcatcgagcc------gttgagcc----------------tcggcggcgg
A0A8B9LSW6_BMF-02       gcatcgagcc------gttgagcc----------------tcggcggcgg
A0A8B9LSW6_BMF-01       gcatcgagcc------gttgagcc----------------tcggcggcgg
A0A3B1JXK6_BCL2L11      gctcagagtttcga--gttatgtccaggacctaa-------ccactgtcc
A0A8B9HBP0_BCL2L11      gctcagagtttcga--gttatgtccaggacctaa-------ccactgtcc
A0A3B1JLM2_BAD-01       gcttcagcagaggacggtggtgtcggtgacggagcaccattccgaggccg
A0A8B9KQD8_BAD-01       gcttcagcagaggacggtggtgtcggtgacggagcaccattccgaggccg
A0A3B1IH05_BAD-01       gctgggagacacgaagatggagctcgagatggagattcattccgacgccg
A0A8B9JSR5_BAD-01       gctgggagacacgaagatggagctcgagatggagattcattccgacgccg
                        **               *   *                   *    *   

A0A3B1K1X5_BMF-01       ccggcgcacagc------------gtggaggccc----gtatcgga----
A0A8B9LSW6_BMF-02       ccggcgcacagc------------gtggaggccc----gtatcgga----
A0A8B9LSW6_BMF-01       ccggcgcacagc------------gtggaggccc----gtatcgga----
A0A3B1JXK6_BCL2L11      accccacagagcagcggctgcg--ggggacatgcaagcgcattggtacat
A0A8B9HBP0_BCL2L11      accccacagagcagcggctgcg--ggggacatgcaagcgcattggtacat
A0A3B1JLM2_BAD-01       atcccagtcagctcctgctgcgctatggaaagccaagaaatatgga----
A0A8B9KQD8_BAD-01       atcccagtcagctcctgctgcgctatggaaagccaagaaatatgga----
A0A3B1IH05_BAD-01       cagccgctcagctcccccttctctgtgggcagccaagaaatatggc----
A0A8B9JSR5_BAD-01       cagccgctcagctcccccttctctgtgggcagccaagaaatatggc----
                            *    ***              **     *         **     

A0A3B1K1X5_BMF-01       ----cagaagctccagatgatcggagaccagttttatcaagagcacatgc
A0A8B9LSW6_BMF-02       ----cagaagctccagatgatcggagaccagttttatcaagagcacatgc
A0A8B9LSW6_BMF-01       ----cagaagctccagatgatcggagaccagttttatcaagagcacatgc
A0A3B1JXK6_BCL2L11      cgcgcaagagttgcgacgcattggggatgaattc------aacgatctgt
A0A8B9HBP0_BCL2L11      cgcgcaagagttgcgacgcattggggatgaattc------aacgatctgt
A0A3B1JLM2_BAD-01       ----cggcagttgaggaggatgagcgatgagttt------gacacctggt
A0A8B9KQD8_BAD-01       ----cggcagttgaggaggatgagcgatgagttt------gacacctggt
A0A3B1IH05_BAD-01       ----cgacagctgaggaagatgagtgacgagttt------gacaaggggc
A0A8B9JSR5_BAD-01       ----cgacagctgaggaagatgagtgacgagttt------gacaaggggc
                            *   ** *       **  * **  * **        *      * 

A0A3B1K1X5_BMF-01       tgcaacacagaaaccaaaggaaccagcagccgctttggttgc-----gct
A0A8B9LSW6_BMF-02       tgcaacacagaaaccaaaggaaccagcagccgctttggttgc-----gct
A0A8B9LSW6_BMF-01       tg-------------gatggaagcaatgttgtccactgttgcaaagagct
A0A3B1JXK6_BCL2L11      acttccgaggggcaggcagaaatggaggtggtgcccaacttc--------
A0A8B9HBP0_BCL2L11      acttccgaggggcaggcagaaatggaggtggtgcccaacttc--------
A0A3B1JLM2_BAD-01       tggacaaaggggacttaaga--------------agaacaac--------
A0A8B9KQD8_BAD-01       tggacaaaggggacttaaga--------------agaacaac--------
A0A3B1IH05_BAD-01       tagagcaaggga--tgaagagggtgaggagtgccggagcagc--------
A0A8B9JSR5_BAD-01       tagagcaaggga--tgaagagggtgaggagtgccggagcagc--------
                                          *                      *        

A0A3B1K1X5_BMF-01       tggcgtc------------------------ggcgctctacacgctcctg
A0A8B9LSW6_BMF-02       tggcgtc------------------------ggcgctctacacgctcctg
A0A8B9LSW6_BMF-01       tggcattgagag-----gagctgcagtgcgagacattttccacg-tcctg
A0A3B1JXK6_BCL2L11      ctgcacaaaatgaacccgccttcatactgtggatggggc------tcctg
A0A8B9HBP0_BCL2L11      ctgcacaaaatgaacccgccttcatactgtggatggggc------tcctg
A0A3B1JLM2_BAD-01       tggccctgggag-----gcataccaaccgaggatggttc------tcttt
A0A8B9KQD8_BAD-01       tggccctgggag-----gcataccaaccgaggatggttc------tcttt
A0A3B1IH05_BAD-01       ccgcc---agat-----gcaaaactcccccagctggttt------gcctt
A0A8B9JSR5_BAD-01       ccgcc---agat-----gcaaaactcccccagctggttt------gcctt
                          **                           *              * * 

A0A3B1K1X5_BMF-01       ttcgagagggagccggcggctcacgggaggcgagaggaccg---------
A0A8B9LSW6_BMF-02       ttcgagagggagccggcggctcacgggaggcgagaggaccg---------
A0A8B9LSW6_BMF-01       catttgttttggccagacatttccttcagcaaag----tct---------
A0A3B1JXK6_BCL2L11      attgaacgtctccgacagttcctccacagaag------------------
A0A8B9HBP0_BCL2L11      attgaacgtctccgacagttcctccacagaag------------------
A0A3B1JLM2_BAD-01       cctctggggtaccaaagaa---------gaggagggaag-----------
A0A8B9KQD8_BAD-01       cctctggggtaccaaagaa---------gaggagggaag-----------
A0A3B1IH05_BAD-01       tctttggagtcacaaggaatcagactctgaggcgagcagcagccgtccag
A0A8B9JSR5_BAD-01       tctttggagtcacaaggaatcagactctgaggcgagcagcagccgtccag
                                    *               *                     

A0A3B1K1X5_BMF-01       -gaggtga
A0A8B9LSW6_BMF-02       -gaggtga
A0A8B9LSW6_BMF-01       -gatgtga
A0A3B1JXK6_BCL2L11      -aagatga
A0A8B9HBP0_BCL2L11      -aagatga
A0A3B1JLM2_BAD-01       -agaataa
A0A8B9KQD8_BAD-01       -agaataa
A0A3B1IH05_BAD-01       cagaatga
A0A8B9JSR5_BAD-01       cagaatga
                             * *

© 1998-2022Legal notice