Dataset for CDS BCL2L11 of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1JXK6_BCL2L11      atgtccagaccgtcaaaccgggccacccgcccacccttcttaaaggagca
A0A8B9HBP0_BCL2L11      ----------------------gctctcggtctc----------------
                                               * * **  * *                

A0A3B1JXK6_BCL2L11      gggggaacgcggccagagcggcgggggcggcggaacattgtcccgagccg
A0A8B9HBP0_BCL2L11      -------cggggttgtgacggcgggggcggcggaacattgtcccgagccg
                               ** **      ********************************

A0A3B1JXK6_BCL2L11      agcagtgcgagcagcctgagcccggcgatggcgacccggttaggggaccc
A0A8B9HBP0_BCL2L11      agcagtgcgagcagcctgagcccggcgatggcgacccggttaggggaccc
                        **************************************************

A0A3B1JXK6_BCL2L11      cctgcgctgcacaatagccttctcggttaccagacccggtcgccgctgtt
A0A8B9HBP0_BCL2L11      cctgcgctgcacaatagccttctcggttaccagacccggtcgccgctgtt
                        **************************************************

A0A3B1JXK6_BCL2L11      ccgaactctctccaggtcctcgagtggatatttctcgttcgacagcgagc
A0A8B9HBP0_BCL2L11      ccgaactctctccaggtcctcgagtggatatttctcgttcgacagcgagc
                        **************************************************

A0A3B1JXK6_BCL2L11      ccagctccccgctcctgatgcacagcgcgtccactcagaccccgagtcca
A0A8B9HBP0_BCL2L11      ccagctccccgctcctgatgcacagcgcgtccactcagaccccgagtcca
                        **************************************************

A0A3B1JXK6_BCL2L11      tctagccaagtcataattcacgcccttcagcgcatttccgaggcgcgagg
A0A8B9HBP0_BCL2L11      tctagccaagtcataattcacgcccttcagcgcatttccgaggcgcgagg
                        **************************************************

A0A3B1JXK6_BCL2L11      cgacgctcagagtttcgagttatgtccaggacctaaccactgtccacccc
A0A8B9HBP0_BCL2L11      cgacgctcagagtttcgagttatgtccaggacctaaccactgtccacccc
                        **************************************************

A0A3B1JXK6_BCL2L11      acagagcagcggctgcgggggacatgcaagcgcattggtacatcgcgcaa
A0A8B9HBP0_BCL2L11      acagagcagcggctgcgggggacatgcaagcgcattggtacatcgcgcaa
                        **************************************************

A0A3B1JXK6_BCL2L11      gagttgcgacgcattggggatgaattcaacgatctgtacttccgaggggc
A0A8B9HBP0_BCL2L11      gagttgcgacgcattggggatgaattcaacgatctgtacttccgaggggc
                        **************************************************

A0A3B1JXK6_BCL2L11      aggcagaaatggaggtggtgcccaacttcctgcacaaaatgaacccgcct
A0A8B9HBP0_BCL2L11      aggcagaaatggaggtggtgcccaacttcctgcacaaaatgaacccgcct
                        **************************************************

A0A3B1JXK6_BCL2L11      tcatactgtggatggggctcctgattgaacgtctccgacagttcctccac
A0A8B9HBP0_BCL2L11      tcatactgtggatggggctcctgattgaacgtctccgacagttcctccac
                        **************************************************

A0A3B1JXK6_BCL2L11      agaagaagatga
A0A8B9HBP0_BCL2L11      agaagaagatga
                        ************

© 1998-2022Legal notice