Dataset for CDS classical BH3-containing proteins of organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8QRJ7_BAD-01      atggctgcaaacttcaaaatttcagacagtgattcagaggcatcagagga
A0A3P8NFE2_BMF-01      atggacga-----tgagga----ggacgatgtgtttgagcca--------
A0A3P8NFE2_BMF-02      atggacga-----tgagga----ggacgatgtgtttgagcca--------
                       ****  *      * *  *     ***  **  *  *** **        

A0A3P8QRJ7_BAD-01      ggtaggggaaggagaaaaccaacagtcagcaggacaagctcaagaaagca
A0A3P8NFE2_BMF-01      --------------aaagccaactgttggcgcaccacattcagggagata
A0A3P8NFE2_BMF-02      --------------aaagccaactgttggcgcaccacattcagggagata
                                     *** ***** **  **    **   *** * *   *

A0A3P8QRJ7_BAD-01      ag----------------ccccagacactt--tcccttcctgtaaccaaa
A0A3P8NFE2_BMF-01      aagtgtgaacatcgaggcacacagacacccggtcctgccctggtacc-aa
A0A3P8NFE2_BMF-02      aagtgtgaacatcgaggcacacagacacccggtcctgccctggtacc-aa
                       *                  * *******    ***   ****  *** **

A0A3P8QRJ7_BAD-01      acgacagc-tgctg------gaaggctcagggtgaactcagagtcccaca
A0A3P8NFE2_BMF-01      acaacggcatgctgccctgtggagtcgcagag-gagcccaga---ccact
A0A3P8NFE2_BMF-02      acaacggcatgctgccctgtggagtcgcagag-gagcccaga---ccact
                       ** ** ** *****      * ** * *** * ** * ****   **** 

A0A3P8QRJ7_BAD-01      cttc----------------ctcaattg-----ccagggatgag--gagc
A0A3P8NFE2_BMF-01      cttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagc
A0A3P8NFE2_BMF-02      cttctacggtaacgcaggttttcgattgcacttcccggcacgcttcgagc
                       ****                 ** ****     ** ** * *    ****

A0A3P8QRJ7_BAD-01      tcatggctagaggggaggatgaggtctgtactcccacagagggagac-cc
A0A3P8NFE2_BMF-01      tcgt------cgggga-----------------tcacagagcgagtcgac
A0A3P8NFE2_BMF-02      tcgt------cgggga-----------------tcacagagcgagtcgac
                       ** *       *****                  ******* *** *  *

A0A3P8QRJ7_BAD-01      attcaggcgaaggtca--aagtcagctc----cccctgctctgtgggctg
A0A3P8NFE2_BMF-01      aaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcga
A0A3P8NFE2_BMF-02      aaggaagcacggagcagcaaaacagcatggagcgcctgccccgccagcga
                       *   * **   *  **  **  ****      * ***** * *   **  

A0A3P8QRJ7_BAD-01      cc----------------aagaagtacggcaggcag---cttcgacgaat
A0A3P8NFE2_BMF-01      cccgcggctcgcagcgtggaggcctgcattggacagaaactccagctcat
A0A3P8NFE2_BMF-02      cccgcggctcgcagcgtggaggcctgcattggacagaaactccagctcat
                       **                 **   * *    * ***   ** *  *  **

A0A3P8QRJ7_BAD-01      gagtgacgagttt------gacagcttac-----------tagataaagg
A0A3P8NFE2_BMF-01      aggagaccagtttcactgggaacgcctgcaactgtatcaccgaaaccaaa
A0A3P8NFE2_BMF-02      aggagaccagtttcactgggaacgcctgcaactgg-----tgaaagcaag
                         * *** *****      **  ** * *              *   *  

A0A3P8QRJ7_BAD-01      ggagatgaaggtcaa-------gaagctgc----accactctaaaacctg
A0A3P8NFE2_BMF-01      ggaaccaggggccgatgtggtggcgcctg-----gccgcggccattctca
A0A3P8NFE2_BMF-02      tagaatacaaacatgctggctggaaactgctgaagcttatgcaacaccct
                                             *   ***      *       *  *   

A0A3P8QRJ7_BAD-01      gtggagctatctctttagtcaccaagagactgaagg--agagaacaacca
A0A3P8NFE2_BMF-01      gc--------cttctgtttgatag-ggggttcatagccggagga------
A0A3P8NFE2_BMF-02      gcaaagttcaccacagtgtgataacggtatggaaacccagaggcttatca
                       *         *       * *    *      *      ***        

A0A3P8QRJ7_BAD-01      tcttgaaaaccacaaccaacgcactgagtaa
A0A3P8NFE2_BMF-01      ----gggggtggaggacgg--aggtga----
A0A3P8NFE2_BMF-02      cagtggcagttcttgactgttaactag----
                           *           *       *      

© 1998-2022Legal notice