Dataset for CDS classical BH3-containing proteins of organism Aquila chrysaetos chrysaetos

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A663E983_BCL2L11      atcac---------------------------------------------
A0A663DZQ4_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A663E970_BCL2L11      atggct------------------aagcaaccccccgaggtgaaagcgca
A0A663FH84_PMAIP1-      atgcct-------------------ggcaggaccct---------gcgca

A0A663E983_BCL2L11      ---------------------------------acaggctgctccct---
A0A663DZQ4_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A663E970_BCL2L11      acgcgacggcg-------------------aaggcgggcggctaccgccg
A0A663FH84_PMAIP1-      aggccgcgcc-----------------------gcccgccgctcccgcag
                                                          *  ** * *       

A0A663E983_BCL2L11      -----------------------------------------------tct
A0A663DZQ4_BMF-01       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A663E970_BCL2L11      gcggaggggccg-------------------ggcccggccgcgcagctgc
A0A663FH84_PMAIP1-      ggcgggaggtgg-------------------ag-------gcgcag-tgc

A0A663E983_BCL2L11      cccctgaagacgt-------------------------------------
A0A663DZQ4_BMF-01       cttctggggaggtttcaactattccccctcacacactgctgtggtcccg-
A0A663E970_BCL2L11      gccccggag---------------ctcccgccgctctgcccggctcccgc
A0A663FH84_PMAIP1-      gccctgcag---------------ct--------------------gcgc
                           * *  *                                         

A0A663E983_BCL2L11      -acagcccgaaatctggattgc---acagg---------agctgcggcgc
A0A663DZQ4_BMF-01       -gtatcaggcatcctgagcagcaggacaaggcaactcaaacactcagccc
A0A663E970_BCL2L11      agccccgcgc-ccctcagctgc--gacaaggccacgcagacccccagccc
A0A663FH84_PMAIP1-      aggatcg-------------gc--gacaag-----tgggacctgcggc--
                             *              **   *** *         *    * **  

A0A663E983_BCL2L11      attgga--------------------------------------gatgag
A0A663DZQ4_BMF-01       gtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagc
A0A663E970_BCL2L11      gccct---------------------------------------gccagg
A0A663FH84_PMAIP1-      --------------------------------------------agaaga

A0A663E983_BCL2L11      ttcaatgcctcctattgtccaagaagggtaactttcatcttttcactttc
A0A663DZQ4_BMF-01       cccggagactcttctatggcaatgctggttaccgtttacacgtccctcca
A0A663E970_BCL2L11      ccctcagccactgcctcagcgccatgggtgactcctcactcggttttttg
A0A663FH84_PMAIP1-      tcctgaac-----------------------ctcctcacgaagctattc-
                          *                            *      *       *   

A0A663E983_BCL2L11      catttctttgcgcactgtct------------------------------
A0A663DZQ4_BMF-01       gttggctttgcgttggatccgcacctccaagaggagcctcaggaaggtca
A0A663E970_BCL2L11      ctcttgtttcttcacaagcca-----------------------------
A0A663FH84_PMAIP1-      --------------------------------------------------

A0A663E983_BCL2L11      ----------------------ctaaaagggaaaagcttaatcatctctg
A0A663DZQ4_BMF-01       gcgggaagcgcgtgccgaggtgcagattgcacggaagttgcagtgcattg
A0A663E970_BCL2L11      ---------------cgtggtgtcataggcgctagggtcgta--------
A0A663FH84_PMAIP1-      --------------------------------------------------

A0A663E983_BCL2L11      gaaactagttct--------------------------------------
A0A663DZQ4_BMF-01       ccgaccagttccaccggctccacatacagaggcatcagcagaacagaaat
A0A663E970_BCL2L11      -----caactcc--------------------------------------
A0A663FH84_PMAIP1-      --------ttcc--------------------------------------

A0A663E983_BCL2L11      --------------------------------------------------
A0A663DZQ4_BMF-01       caagtgtggtggcagctttttctcttcctacacaacttggccttaaacgc
A0A663E970_BCL2L11      -----------------------------------------------cgc
A0A663FH84_PMAIP1-      -----------------------------------------------cg-

A0A663E983_BCL2L11      ---------------------------gtggtga
A0A663DZQ4_BMF-01       ggaggtgaacaggaaccacactgggcagaggtga
A0A663E970_BCL2L11      ttgttttggtgagacccaaaattggt--gcttga
A0A663FH84_PMAIP1-      ----------gaga---------------cgtga

© 1998-2021Legal notice