Dataset for CDS BMF of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5E1Q4_BMF-01      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagtc
A0A2K5E1Q4_BMF-02      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagtc
                       **************************************************

A0A2K5E1Q4_BMF-01      agaggatggggagccagggacccaacccgggagcttgctctctgctgacc
A0A2K5E1Q4_BMF-02      agaggatggggagccagggacccaacccgggagcttgctctctgctgacc
                       **************************************************

A0A2K5E1Q4_BMF-01      tgtttgcccagagcctactggactgccccctcagccggcttcagctcttc
A0A2K5E1Q4_BMF-02      tgtttgcccagagcctactggactgccccctcagccggcttcagctcttc
                       **************************************************

A0A2K5E1Q4_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K5E1Q4_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A2K5E1Q4_BMF-01      caaggctacccagaccctcagcccagcctcccccagccaaggtgtcatgc
A0A2K5E1Q4_BMF-02      caaggctacccagaccctcagcccagcctcccccagccaaggtgtcatgc
                       **************************************************

A0A2K5E1Q4_BMF-01      tgccttgtggggtgactgaggaaccccagcgactcttttacggcaatgct
A0A2K5E1Q4_BMF-02      tgccttgtggggtgactgaggaaccccagcgactcttttacg--------
                       ******************************************        

A0A2K5E1Q4_BMF-01      ggctatcggcttcctctccctgccagtttcccagcagtcttgccccttgg
A0A2K5E1Q4_BMF-02      --------------------------------------------------
                                                                         

A0A2K5E1Q4_BMF-01      ggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K5E1Q4_BMF-02      --------------------------------------------------
                                                                         

A0A2K5E1Q4_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K5E1Q4_BMF-02      --------------------------------------------------
                                                                         

A0A2K5E1Q4_BMF-01      caacatcagcagaaccgaaatcgcgtgtggtggcaggtcctcctctttct
A0A2K5E1Q4_BMF-02      ---catcagcagaaccgaaatcgcgtgtggtggcaggtcctcctctttct
                          ***********************************************

A0A2K5E1Q4_BMF-01      gcacaacctggctttgaatggagaagagaacaggaatggggcaggcccga
A0A2K5E1Q4_BMF-02      gcacaacctggctttgaatggagaagagaacaggaatggggcaggcccga
                       **************************************************

A0A2K5E1Q4_BMF-01      ggtga
A0A2K5E1Q4_BMF-02      g----
                       *    

© 1998-2020Legal notice