Dataset for CDS BCL2L11 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA52_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag

A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA52_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta

A0A2K5CA52_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5CA52_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5CA52_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5CA52_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5CA52_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt

A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CA52_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CA52_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CA52_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CA52_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5CA52_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc

A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CA52_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CA52_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CA52_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CA52_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A2K5CA52_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga

A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CA52_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CA52_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CA52_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CA52_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5CA52_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac

A0A2K5CA52_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA52_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc

A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgata
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggatgagg
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5CA52_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggct----

A0A2K5CA52_BCL2L11      t---ttcattgtggtttagatttatatttaccttctttgatttgtatggc
A0A2K5CA52_BCL2L11      ccactgaatcctcccttggaattgc-----ccttcgtagggaggttcagt
A0A2K5CA52_BCL2L11      ---------------------------------------agagaaataga
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CA52_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CA52_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CA52_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CA52_BCL2L11      tgaggcaatctcaggctgaacctgca--ggtatgcgcccggagatatgga
A0A2K5CA52_BCL2L11      -------------gact---------------------------------

A0A2K5CA52_BCL2L11      caccaccacagtcaaggtacagaacaactccaccacaagtatttctcatg
A0A2K5CA52_BCL2L11      ggccacttgagtggt----tagcaaaatcaagctga--------------
A0A2K5CA52_BCL2L11      ------ggaagttgtcgtgtag----------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CA52_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CA52_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CA52_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CA52_BCL2L11      tcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatcca
A0A2K5CA52_BCL2L11      ------------------------gggactag------------------

A0A2K5CA52_BCL2L11      a-------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      ----gggtattttt-------gaataa-----------------------
A0A2K5CA52_BCL2L11      aggagggtattttt-------gaataattaccaagcagccgaagaccacc
A0A2K5CA52_BCL2L11      aggagggtattttt-------gaataattaccaagcagccgaagaccacc
A0A2K5CA52_BCL2L11      aggagggtattttt-------gaataattaccaagcagccgaagaccacc
A0A2K5CA52_BCL2L11      aggaggatatctcttccatctgattga-----------------------
A0A2K5CA52_BCL2L11      aggaggtta------------gagaaatag--------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------

A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      cacacatggttatcttacgactgttacgttacattgtccgcctggtgtgg
A0A2K5CA52_BCL2L11      cacacatggttatcttacgactgttacgttacattgtccgcctggtgtgg
A0A2K5CA52_BCL2L11      cacacatggttatcttacgactgttacgttacattgtccgcctggtgtgg
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------
A0A2K5CA52_BCL2L11      --------------------------------------------------

A0A2K5CA52_BCL2L11      ------------
A0A2K5CA52_BCL2L11      ------------
A0A2K5CA52_BCL2L11      ------------
A0A2K5CA52_BCL2L11      ------------
A0A2K5CA52_BCL2L11      agaatgcattga
A0A2K5CA52_BCL2L11      agaatgcattga
A0A2K5CA52_BCL2L11      agaatgcattga
A0A2K5CA52_BCL2L11      ------------
A0A2K5CA52_BCL2L11      ------------
A0A2K5CA52_BCL2L11      ------------

© 1998-2022Legal notice