Dataset for CDS BCL2L11 of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5CA89_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5CA89_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5CA89_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
A0A2K5CA89_BCL2L11      acaattgcagcctgcggagagacctccccagctcagacctggggccccta
                        **************************************************

A0A2K5CA89_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5CA89_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **********************                            

A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                          

A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
                                                                          

A0A2K5CA89_BCL2L11      --------------------------------------------------
A0A2K5CA89_BCL2L11      gaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A2K5CA89_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5CA89_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2K5CA89_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgata
A0A2K5CA89_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
                        ******************************************** *   *

A0A2K5CA89_BCL2L11      t---ttcattgtggtttagatttata--tttaccttctttgatttgtatg
A0A2K5CA89_BCL2L11      tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatc
                        *      **    *  *  *  *  *  * * *   *   *** ** ** 

A0A2K5CA89_BCL2L11      gccaccaccacagtcaaggtaca----gaacaactccaccac--------
A0A2K5CA89_BCL2L11      gcc----caagagttgcggcgtatcggagacgagtttaacgcttattatc
                        ***    * * ***   **   *      ** * *  * * *        

A0A2K5CA89_BCL2L11      ----aagtatttctc----------atga
A0A2K5CA89_BCL2L11      caaggaggatatctcttccatctgattga
                             ** ** ****           ***

© 1998-2020Legal notice