Dataset for CDS BAD of organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5E6A6_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2K5E6A6_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
                       **************************************************

A0A2K5E6A6_BAD-01      tgcagagaggggcctgagccccagcaccgcaggggacaggcccccaggct
A0A2K5E6A6_BAD-03      tgcagagaggggcctgagccccagcaccgcaggggacaggcccccaggct
                       **************************************************

A0A2K5E6A6_BAD-01      ctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcac
A0A2K5E6A6_BAD-03      ctggcaagcatccacgccaggccccaggcctcccaggggacgccagtcac
                       **************************************************

A0A2K5E6A6_BAD-01      cagcagggacagccaaccagcagcagccaccatggaggcg----------
A0A2K5E6A6_BAD-03      cagcagggacagccaaccagcagcagccaccatggaggtgagtactccac
                       ************************************** *          

A0A2K5E6A6_BAD-01      ctggggctgtg-----------gaga-------------------cccga
A0A2K5E6A6_BAD-03      ttgtgcctctgcttcctcatctgagaatcccagtgcaaggatgctctcga
                        ** * ** **           ****                   * ***

A0A2K5E6A6_BAD-01      a-------------------------------------------------
A0A2K5E6A6_BAD-03      aagcatcagcagggatgtccgccccagccactgactcagaaaatgtaaag
                       *                                                 

A0A2K5E6A6_BAD-01      ------------------gtcgccacagctcctaccccgcagggacggag
A0A2K5E6A6_BAD-03      ctggaggtgccttgctgggtcgccacagctcctaccccgcagggacggag
                                         ********************************

A0A2K5E6A6_BAD-01      gaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
A0A2K5E6A6_BAD-03      gaggacgaagggatggaggaggagcccagcccctttcggggccgttcgcg
                       **************************************************

A0A2K5E6A6_BAD-01      ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctcc
A0A2K5E6A6_BAD-03      ctcagcaccccccaacctctgggcagcacagcgctatggccgcgagctcc
                       **************************************************

A0A2K5E6A6_BAD-01      ggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccg
A0A2K5E6A6_BAD-03      ggaggatga-----------------------------------------
                       *********                                         

A0A2K5E6A6_BAD-01      aagagcgcgggcacagcaacgcagatgcggcaaagctccagttggacgca
A0A2K5E6A6_BAD-03      --------------------------------------------------
                                                                         

A0A2K5E6A6_BAD-01      agtcatccagtcctggtgggatcggaacttgggcaggggaggctccgctc
A0A2K5E6A6_BAD-03      --------------------------------------------------
                                                                         

A0A2K5E6A6_BAD-01      cctcccagtga
A0A2K5E6A6_BAD-03      -----------
                                  

© 1998-2020Legal notice