Dataset for CDS BMF of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A803SZ00_BMF-01      atggatcctcccggctacttggatgatgacttctccactttggatgggct
A0A803SZ00_BMF-02      atggatcctcccggctacttggatgatgacttctccactttggatgggct
A0A803SZ00_BMF-03      atggatcctcccggctacttggatgatgacttctccactttggatgggct
                       **************************************************

A0A803SZ00_BMF-01      ggaggatgatgtgttccatgcagaagactgtggacttgccagtcaaccca
A0A803SZ00_BMF-02      ggaggatgatgtgttccatgcagaagactgtggacttgccagtcaaccca
A0A803SZ00_BMF-03      ggaggatgatgtgttccatgcagaagactgtggacttgccagtcaaccca
                       **************************************************

A0A803SZ00_BMF-01      gtgagatgacctttcctggcattttcactcagagcaaatcctacaactgt
A0A803SZ00_BMF-02      gtgagatgacctttcctggcattttcactcagagcaaatcctacaactgt
A0A803SZ00_BMF-03      gtgagatgacctttcctggcattttcactcagagcaaatcctacaactgt
                       **************************************************

A0A803SZ00_BMF-01      cttctggggaggttccagctcttcccacttacacactgttgtggccctgg
A0A803SZ00_BMF-02      cttctggggaggttccagctcttcccacttacacactgttgtggccctgg
A0A803SZ00_BMF-03      cttctggggaggttccagctcttcccacttacacactgttgtggccctgg
                       **************************************************

A0A803SZ00_BMF-01      cagtaggcaggccaggcagcaagacaaggcaacacaaacactcaacccat
A0A803SZ00_BMF-02      cagtaggcaggccaggcagcaagacaaggcaacacaaacactcaacccat
A0A803SZ00_BMF-03      cagtaggcaggccaggcagcaagacaaggcaacacaaacactcaacccat
                       **************************************************

A0A803SZ00_BMF-01      cctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
A0A803SZ00_BMF-02      cctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
A0A803SZ00_BMF-03      cctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
                       **************************************************

A0A803SZ00_BMF-01      cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaat
A0A803SZ00_BMF-02      cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaat
A0A803SZ00_BMF-03      cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaat
                       **************************************************

A0A803SZ00_BMF-01      tggtttctcattgaatccacacttccaggaggagccccaggagagtccac
A0A803SZ00_BMF-02      tggtttctcattgaatccacacttccaggaggagccccaggagagtccac
A0A803SZ00_BMF-03      tggtttctcattgaatccacacttccaggaggagccccaggagagtccac
                       **************************************************

A0A803SZ00_BMF-01      aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgca
A0A803SZ00_BMF-02      aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgca
A0A803SZ00_BMF-03      aggaactgcgtactgaagttcagattgcacggaagttgcagtgcattgca
                       **************************************************

A0A803SZ00_BMF-01      gaccagttccacaggcttcacctacagaggcacaacatgggcctccttct
A0A803SZ00_BMF-02      gaccagttccacaggcttcacctacagaggcaccagcagaa---------
A0A803SZ00_BMF-03      gaccagttccacaggcttcacctacagaggcaccagcagaa---------
                       ********************************* *   *           

A0A803SZ00_BMF-01      ctggacatcttcagaaagaggat----gggcagatccctcctgtggatgc
A0A803SZ00_BMF-02      -----------cagaaaccaggtctggtggcagat-cttcttcttcctcc
A0A803SZ00_BMF-03      -----------cagaaaccaggtctggtggcagat-cttcttcttcctcc
                                  ******   * *     ******* * ** * *   * *

A0A803SZ00_BMF-01      tttacctggcgatcctgcac---taagcaaaga---attgaactcaatgg
A0A803SZ00_BMF-02      ataacgtggc---cttgaacatggaggcaaacagacatcgtgct-----g
A0A803SZ00_BMF-03      ataacgtggc---cttgaacatggaggcaaacagacatcgtgct-----g
                        * ** ****   * ** **    * ***** *   ** *  **     *

A0A803SZ00_BMF-01      tccaaagggcccctttcaactctatgcctcttag----------------
A0A803SZ00_BMF-02      gccgtagttgtaccacaacctattttccttttactgagcctccggtgtgt
A0A803SZ00_BMF-03      gccgtagg------------------------------------------
                        **  **                                           

A0A803SZ00_BMF-01      ------------------------------------------------
A0A803SZ00_BMF-02      tttccattctctgaaatgctgccaagattctgtctagaggctatctga
A0A803SZ00_BMF-03      ---------------------------------------------tga
                                                                       

© 1998-2022Legal notice