Dataset for CDS BMF of organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H9GL49_BMF-01      atggatcctcccggctacttggatgatgacttctccactttggatgggctggaggatgat
H9GL49_BMF-02      atggatcctcccggctacttggatgatgacttctccactttggatgggctggaggatgat
H9GL49_BMF-03      atggatcctcccggctacttggatgatgacttctccactttggatgggctggaggatgat
                   ************************************************************

H9GL49_BMF-01      gtgttccatgcagaagactgtggacttgccagtcaacccagtgagatgacctttcctggc
H9GL49_BMF-02      gtgttccatgcagaagactgtggacttgccagtcaacccagtgagatgacctttcctggc
H9GL49_BMF-03      gtgttccatgcagaagactgtggacttgccagtcaacccagtgagatgacctttcctggc
                   ************************************************************

H9GL49_BMF-01      attttcactcagagcaaatcctacaactgtcttctggggaggttccagctcttcccactt
H9GL49_BMF-02      attttcactcagagcaaatcctacaactgtcttctggggaggttccagctcttcccactt
H9GL49_BMF-03      attttcactcagagcaaatcctacaactgtcttctggggaggttccagctcttcccactt
                   ************************************************************

H9GL49_BMF-01      acacactgttgtggccctggcagtaggcaggccaggcagcaagacaaggcaacacaaaca
H9GL49_BMF-02      acacactgttgtggccctggcagtaggcaggccaggcagcaagacaaggcaacacaaaca
H9GL49_BMF-03      acacactgttgtggccctggcagtaggcaggccaggcagcaagacaaggcaacacaaaca
                   ************************************************************

H9GL49_BMF-01      ctcaacccatcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
H9GL49_BMF-02      ctcaacccatcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
H9GL49_BMF-03      ctcaacccatcctcttccagccaggatgtgatgttaccttgtggagtcacagaagaaccc
                   ************************************************************

H9GL49_BMF-01      cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaattggtttctca
H9GL49_BMF-02      cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaattggtttctca
H9GL49_BMF-03      cagagactcttctatgggaatgctgggtaccgtttacacgtcagcccaattggtttctca
                   ************************************************************

H9GL49_BMF-01      ttgaatccacacttccaggaggagccccaggagagtccacaggaactgcgtactgaagtt
H9GL49_BMF-02      ttgaatccacacttccaggaggagccccaggagagtccacaggaactgcgtactgaagtt
H9GL49_BMF-03      ttgaatccacacttccaggaggagccccaggagagtccacaggaactgcgtactgaagtt
                   ************************************************************

H9GL49_BMF-01      cagattgcacggaagttgcagtgcattgcagaccagttccacaggcttcacctacagagg
H9GL49_BMF-02      cagattgcacggaagttgcagtgcattgcagaccagttccacaggcttcacctacagagg
H9GL49_BMF-03      cagattgcacggaagttgcagtgcattgcagaccagttccacaggcttcacctacagagg
                   ************************************************************

H9GL49_BMF-01      cacaacatgggcctccttctctggacatcttcagaaagaggat----gggcagatccctc
H9GL49_BMF-02      caccagcagaa--------------------cagaaaccaggtctggtggcagat-cttc
H9GL49_BMF-03      caccagcagaa--------------------cagaaaccaggtctggtggcagat-cttc
                   *** *   *                      ******   * *     ******* * **

H9GL49_BMF-01      ctgtggatgctttacctggcgatcctgcac---taagcaaaga---attgaactcaatgg
H9GL49_BMF-02      ttcttcctccataacgtggc---cttgaacatggaggcaaacagacatcgtgct-----g
H9GL49_BMF-03      ttcttcctccataacgtggc---cttgaacatggaggcaaacagacatcgtgct-----g
                    * *   * * * ** ****   * ** **    * ***** *   ** *  **     *

H9GL49_BMF-01      tccaaagggcccctttcaactctatgcctcttag--------------------------
H9GL49_BMF-02      gccgtagttgtaccacaacctattttccttttactgagcctccggtgtgttttccattct
H9GL49_BMF-03      gccgtagg----------------------------------------------------
                    **  **                                                     

H9GL49_BMF-01      --------------------------------------
H9GL49_BMF-02      ctgaaatgctgccaagattctgtctagaggctatctga
H9GL49_BMF-03      -----------------------------------tga
                                                         

© 1998-2021Legal notice