Dataset for CDS BMF of organism Anas zonorhyncha

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9VI07_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8B9VI07_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8B9VI07_BMF-03      atggatcgccccagctacctggaagaggactattctagcctggatgggct
                       **************************************************

A0A8B9VI07_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8B9VI07_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8B9VI07_BMF-03      ggacgatgacgtgtttcactctgatgactttggacttgca----------
                       ****************************************          

A0A8B9VI07_BMF-02      gtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgc
A0A8B9VI07_BMF-01      gtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgc
A0A8B9VI07_BMF-03      --------------------------------------------------
                                                                         

A0A8B9VI07_BMF-02      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8B9VI07_BMF-01      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8B9VI07_BMF-03      --------------------------------------------------
                                                                         

A0A8B9VI07_BMF-02      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A8B9VI07_BMF-01      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A8B9VI07_BMF-03      --------------------------------------------------
                                                                         

A0A8B9VI07_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8B9VI07_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8B9VI07_BMF-03      --------------------------------------------------
                                                                         

A0A8B9VI07_BMF-02      cggagactcttctatgggaatgctggttaccgtttacacgtccctccagt
A0A8B9VI07_BMF-01      cggagactcttctatgggaatgctggttaccgtttacacgtccctccagt
A0A8B9VI07_BMF-03      ---------------gggaatgctggttaccgtttacacgtccctccagt
                                      ***********************************

A0A8B9VI07_BMF-02      tggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
A0A8B9VI07_BMF-01      tggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
A0A8B9VI07_BMF-03      tggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
                       **************************************************

A0A8B9VI07_BMF-02      aggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgca
A0A8B9VI07_BMF-01      aggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgca
A0A8B9VI07_BMF-03      aggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgca
                       **************************************************

A0A8B9VI07_BMF-02      gaccagttccaccggctccacatacagagggtagggtgtttccaaagggg
A0A8B9VI07_BMF-01      gaccagttccaccggctccacatacaga------ggcatcagcagaacag
A0A8B9VI07_BMF-03      gaccagttccaccggctccacatacaga------ggcatcagcagaacag
                       ****************************      **  *   ** *   *

A0A8B9VI07_BMF-02      aa---------ggtgggggct-----tacttatccaggagtggtgctcct
A0A8B9VI07_BMF-01      aaatcaagtgtggtggcagctttttctctttctacacaacttg---gcct
A0A8B9VI07_BMF-03      aaatcaagtgtggtggcagctttttctctttctacacaacttg---gcct
                       **         *****  ***     *  ** * **  * * *    ***

A0A8B9VI07_BMF-02      gaagcctggctccaggcatcagccaagcaggctgctgcctgaggcagcag
A0A8B9VI07_BMF-01      taaacgtggaggcgaacaggaaccacactgggcagag-------------
A0A8B9VI07_BMF-03      taaacgtggaggcgaacaggaaccacactgggcagagccacagaaaggag
                        ** * ***   *   **  * ***  * **     *             

A0A8B9VI07_BMF-02      gctgccagca-gtga
A0A8B9VI07_BMF-01      -----------gtga
A0A8B9VI07_BMF-03      ggtctcttcctgtga
                                  ****

© 1998-2022Legal notice