Dataset for CDS BMF of organism Anas platyrhynchos platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A493T7X1_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A493T7X1_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct
                       **************************************************

A0A493T7X1_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A493T7X1_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                       **************************************************

A0A493T7X1_BMF-01      gtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgc
A0A493T7X1_BMF-02      gtgagatgactgcaacaggcattttcacacagaaccagtcctacagctgc
                       **************************************************

A0A493T7X1_BMF-01      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A493T7X1_BMF-02      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
                       **************************************************

A0A493T7X1_BMF-01      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A493T7X1_BMF-02      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
                       **************************************************

A0A493T7X1_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A493T7X1_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                       **************************************************

A0A493T7X1_BMF-01      cggagactcttctat-----------------------------------
A0A493T7X1_BMF-02      cggagactcttctatgggaatgctggttaccgtttacatgtccctccagt
                       ***************                                   

A0A493T7X1_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-02      tggctttgcattggatccacacctccaagaggagcctcaggaaggtcagc
                                                                         

A0A493T7X1_BMF-01      --------------------------------------------------
A0A493T7X1_BMF-02      aggaggcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgca
                                                                         

A0A493T7X1_BMF-01      -----------------------------gcatcagcagaacagaaatca
A0A493T7X1_BMF-02      gaccagttccaccggctccacatacagaggcatcagcagaacagaaatca
                                                    *********************

A0A493T7X1_BMF-01      agtgtggtggcagctttttctctttctacacaacttggccttaaacgtgg
A0A493T7X1_BMF-02      agtgtggtggcagctttttctctttctacacaacttggccttaaacgtgg
                       **************************************************

A0A493T7X1_BMF-01      aggcgaacaggaaccacactgggcagaggtgagcttcacccacctgtttc
A0A493T7X1_BMF-02      aggcgaacaggaaccacactgggcagaggtga------------------
                       ********************************                  

A0A493T7X1_BMF-01      aggccacatccagtctgcagggagcactgaacaaacactggttcggggga
A0A493T7X1_BMF-02      --------------------------------------------------
                                                                         

A0A493T7X1_BMF-01      gagacatgcacaccgccggccggatgtgaggactctgaaattcttctact
A0A493T7X1_BMF-02      --------------------------------------------------
                                                                         

A0A493T7X1_BMF-01      cgtcttcaagtttggggttttatggactcctctttgctgctccctgccct
A0A493T7X1_BMF-02      --------------------------------------------------
                                                                         

A0A493T7X1_BMF-01      gcgaggcagggagctcttgtccaacactgtcgaaggaaagccagaatgtg
A0A493T7X1_BMF-02      --------------------------------------------------
                                                                         

A0A493T7X1_BMF-01      ggtgtgtttggtaaagcttgctgctgggtccccgcaccggtaacctctgt
A0A493T7X1_BMF-02      --------------------------------------------------
                                                                         

A0A493T7X1_BMF-01      gcaggagaggcaggtattaggctaa
A0A493T7X1_BMF-02      -------------------------
                                                

© 1998-2020Legal notice