Dataset for CDS classical BH3-containing proteins of organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8RLE2_BCL2L11      gcgaac--------agaacacctagtttagtaggacctgaacagaagaag
A0A3P8RKY9_BMF-01       atggacgatgaggaggatgatgtttttgagccagacccccactgctggcg
A0A3P8TWH6_BAD-01       atggctgc-----aaaattcactatttcagacag-----------cgagt
                          *             *     *  ** **   *            *   

A0A3P8RLE2_BCL2L11      aggaacggagggaacctcagaggcggcggagcagatccagaac-------
A0A3P8RKY9_BMF-01       cacaac--------attcag-ggagat---aaagtgtgaagac-------
A0A3P8TWH6_BAD-01       cagagc--------catcagaggaggtagaagagggagaaaacaaccatt
                           * *          **** ** *       **    *  **       

A0A3P8RLE2_BCL2L11      --ccgtcggtgcagctggggtct--------cggcgaaaac---------
A0A3P8RKY9_BMF-01       --cggggcacacagact---cctggtcctgcc--ctgcaaccaaacaacg
A0A3P8TWH6_BAD-01       caccagcaacacaagccatgcctgttttcgcccgccgcaac------atg
                          *        **        **        *  *   ***         

A0A3P8RLE2_BCL2L11      -----atcccgtttgaactccaccggaggagagccggactccccgtcctg
A0A3P8RKY9_BMF-01       gcatgctgccctgtggagtc--gcagaggagcccagaccactcttctacg
A0A3P8TWH6_BAD-01       gc---cttacct----------------gaactcagaactccagcatctg
                              *  * *                **   * *  * *        *

A0A3P8RLE2_BCL2L11      gtccagagcgcaggccagcctaggcgtgtttcagaccaggtcgatttttc
A0A3P8RKY9_BMF-01       gt----aacgcaggtt---ttcgact----------------------gc
A0A3P8TWH6_BAD-01       gtc---ggctcaggctgaactcggag----------------------tc
                        **      * ****      * *                          *

A0A3P8RLE2_BCL2L11      acctccctcgccgctcctccagtggctatttctccgccgatggtgccgac
A0A3P8RKY9_BMF-01       acttcccagcacgct-tt---gagcttat---------------------
A0A3P8TWH6_BAD-01       ccacgcctccacgct-ctccagaga-------------------------
                         *   **    ****  *   * *                          

A0A3P8RLE2_BCL2L11      tcggtgccgagctccccgctctcaccgaagcgactgacggc--------t
A0A3P8RKY9_BMF-01       ----tgggaatcaccaagcaaggcaacaaggaagtg-------------a
A0A3P8TWH6_BAD-01       ----tgaggagctccaggcgaggggggaagaggaagccggcacgcccaca
                            **   * * **  **        ***     *              

A0A3P8RLE2_BCL2L11      gacaaagc--cacgcagactccgagcccgagcggccaggtgatcaaacac
A0A3P8RKY9_BMF-01       aatggagc---------aaaatgggatggagcagct-------------g
A0A3P8TWH6_BAD-01       gacggagctccgttcagggcacggtccaagtcggct-------------c
                         *   ***              *        * **               

A0A3P8RLE2_BCL2L11      gcgctggagcgcatgaccgatgaggcgcacggaggag---------gacc
A0A3P8RKY9_BMF-01       ccccggcagc----aacctgtggcacgtagcatggaggcttgcattggac
A0A3P8TWH6_BAD-01       cccctgca---------ctgtgggccgc--caagaag---tac---ggcc
                         * * * *         *  **   **      * **         *  *

A0A3P8RLE2_BCL2L11      gggaacgcagcagcacggtgagctcaggctgaca---------------t
A0A3P8RKY9_BMF-01       agaaactccagctgatag-gagaccagtttcaccgggaacacctacaact
A0A3P8TWH6_BAD-01       agcagcttcgaaggatga-gcgatgagtttgacag------cctgcta-g
                         * * *        *    * *   **  * **                 

A0A3P8RLE2_BCL2L11      acacgagggaaatcagttgcacattcaatctctgcaatagtttttgcac-
A0A3P8RKY9_BMF-01       gtatcatcgaaaccaaaggaaccaggggccgctgtggtggcgcctggccg
A0A3P8TWH6_BAD-01       ataaaggggagatgaagagggtgaggag----tgcagggacagccagaca
                          *     ** *  *   *             **              * 

A0A3P8RLE2_BCL2L11      -----gctgttttctgtcactgttttctgtcatcttcagtcgctgtttgc
A0A3P8RKY9_BMF-01       ca---gccgttctcag---------------ccttctgtttgacaggggg
A0A3P8TWH6_BAD-01       gatgcaccactctaaaagctggtggagctacctctttagtcaccaggaga
                              *   * *                     *    *        * 

A0A3P8RLE2_BCL2L11      gtctacgctacaaaacgtcttgattaggtttattaacccaaactacttca
A0A3P8RKY9_BMF-01       ttcattgctggaggaggt---------------------g----------
A0A3P8TWH6_BAD-01       --------tggagggaga---------------------gaacaaccacc
                                *  *    *                                 

A0A3P8RLE2_BCL2L11      gtacattttgga------aaagatgttaa
A0A3P8RKY9_BMF-01       gtgcaggacgga------------ggtga
A0A3P8TWH6_BAD-01       atgaaagccacacacatcgcaatgagtag
                         *  *      *              *  

© 1998-2022Legal notice