Dataset for CDS BAD of organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q0QNQ2_BAD-02      --------------------------------------atgcccgaacca
A0A3Q0QNQ2_BAD-01      ttcatccattttcttccgtttatccagggtcgggggcagcagcctagcca
                                                                 ** * ***

A0A3Q0QNQ2_BAD-02      cct----cgactggt------------------tctttttgatgtagaag
A0A3Q0QNQ2_BAD-01      cctcctgcagctgatctggggaacaccaaggcattcccaggccataggac
                       ***    *  *** *                  *      *   *** * 

A0A3Q0QNQ2_BAD-02      aaggacag------tcacccttcagagaaggctcatttctactgct---t
A0A3Q0QNQ2_BAD-01      atgaccagaacacttcacccatgaggca--------tcctactgccagga
                       * *  ***      ****** * **  *        * *******     

A0A3Q0QNQ2_BAD-02      gtatctg--tgatctcrttcttttggtcactacccaaagctttctccagg
A0A3Q0QNQ2_BAD-01      ggatcaggatgaactcagagtccca--cacttcctcag----tctccagg
                       * *** *  *** ***    *      **** **  *     ********

A0A3Q0QNQ2_BAD-02      gatgaggagctcgtcgtcagaggggaggacgagatctgtactcccacaga
A0A3Q0QNQ2_BAD-01      gatgaggagctcgtcgtcagaggggaggacgagatctgtactcccacaga

A0A3Q0QNQ2_BAD-02      gggagatccattcaggcgaaggtcaaagtccgcaccccctgctctgtggg
A0A3Q0QNQ2_BAD-01      gggagatccattcaggcgaaggtcaaagtccgcaccccctgctctgtggg

A0A3Q0QNQ2_BAD-02      ctgccaagaagtacggccagcagcttcgaaggatgagtgatgagtttgac
A0A3Q0QNQ2_BAD-01      ctgccaagaagtacggccagcagcttcgaaggatgagtgatgagtttgac

A0A3Q0QNQ2_BAD-02      agcctactagataaagggatgaagaaggccaagaatgctgggaccaccag
A0A3Q0QNQ2_BAD-01      agcctactagataaagggatgaagaaggccaagaatgctgggaccaccag

A0A3Q0QNQ2_BAD-02      aaagatgcaccactctaaaacctggtggagctatctctttagtcaccagg
A0A3Q0QNQ2_BAD-01      aaagatgcaccactctaaaacctggtggagctatctctttagtcaccagg

A0A3Q0QNQ2_BAD-02      agagtgatggagagaacagccatcatgaaaaccacacacaacgcactgag
A0A3Q0QNQ2_BAD-01      agagtgatggagagaacagccatcatgaaaaccacacacaacgcactgag

A0A3Q0QNQ2_BAD-02      taa
A0A3Q0QNQ2_BAD-01      taa

© 1998-2020Legal notice