Dataset for CDS classical BH3-containing proteins of organism Amazona collaria

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9EVZ5_PMAIP1-      at------------------------------------------------
A0A8B9FZ48_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
                        **                                                

A0A8B9EVZ5_PMAIP1-      ---------------------------------------------gcctg
A0A8B9FZ48_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                                                                     *****

A0A8B9EVZ5_PMAIP1-      gcaagac-accgc-------------------------------------
A0A8B9FZ48_BMF-01       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
                        *  ***  ** **                                     

A0A8B9EVZ5_PMAIP1-      ------ggaaagctgcgg-----------cgcccaccgc-----------
A0A8B9FZ48_BMF-01       cttctggggaggtttcaactattccccctcacacactgctgtggtcccgg
                              ** * * * *             * * *** **           

A0A8B9EVZ5_PMAIP1-      ---------tcccgcggaggcgga--------------------------
A0A8B9FZ48_BMF-01       tatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
                                 *** * * **  ***                          

A0A8B9EVZ5_PMAIP1-      -----------------------------ggtggtgtc------------
A0A8B9FZ48_BMF-01       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                                                      **** ***            

A0A8B9EVZ5_PMAIP1-      ----------------ggagtgc-----------------gccctgcagc
A0A8B9FZ48_BMF-01       cggagactcttctatgggaatgctggttaccgtttacacatccctccagc
                                        *** ***                  **** ****

A0A8B9EVZ5_PMAIP1-      ------tacgcaggataggcg---acaagtggaacctgcggcaga-----
A0A8B9FZ48_BMF-01       tgactttgcgttggatccgcacctccaagaggagcctcaggaaggtcagc
                              * **  ****  **     **** *** ***  ** **      

A0A8B9EVZ5_PMAIP1-      ---------------------agatc----------------------ct
A0A8B9FZ48_BMF-01       gggaagcgcgtgctgaggtgcagattgcacggaagttgcagtgcattgct
                                             ****                       **

A0A8B9EVZ5_PMAIP1-      gaac-----------ctcctcacgaag-----------------------
A0A8B9FZ48_BMF-01       gaccagttccaccggctccacatacagaggcatcagcagaacagaaatca
                        ** *           **** **   **                       

A0A8B9EVZ5_PMAIP1-      -------------------ctcttct------------------gcccgg
A0A8B9FZ48_BMF-01       agtgtggtggcagctttttctcttcctacacaacttggcgttaaacgcgg
                                           ******                    * ***

A0A8B9EVZ5_PMAIP1-      ------------------------agacatga
A0A8B9FZ48_BMF-01       aggtgaacaggaaccacactgggcagaggtga
                                                ***  ***

© 1998-2022Legal notice