Dataset for CDS classical BH3-containing proteins of organism Accipiter nisus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       cacctggaacaggacggagggctctctttccctgcaaagactggggatgc
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       acaagcagttataagccaaggctgctctcctcgtcgcgcagccctgtccc
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       cgggccgcgggctgggccctctcctccgcctccgtcccacacccggcacc
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       gatgaggagagtggcgaggcgagtacgcggggctcccccccagggctcgc
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       ccggccggccggcgttctgcgagcggggagttgtggggtgacagacggca
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       gcccgggccgcgcccccgcgggggccgggccgggccgggctcagccggcg
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       cctgcccggggaggcgactcccgcccccgcccgcccgcccctcagccggg
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       ccgggccgggccgggccgggcgcacctctcgcgcggcggcggcggttgcc
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       cctcgcggcgcgccccgcccctccccgcccattggccggcgggcgggggc
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       ggggcgcggagggggcggggccgccgtcagctgttcgcggtccgcccggc
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      --------------------------------------------------
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       ggcagcggcggcagtttggcggtggggaggcgcggcggcggctcccggga
A0A8B9MY06_BMF-02       --------------------------------------------------
A0A8B9NIC6_BAD-01       --------------------------------------------------
A0A8B9NIC6_BAD-02       --------------------------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      -----------------------------------------atg----gc
A0A8B9ME52_PMAIP1-      -----------------------------------------atg------
A0A8B9MY06_BMF-01       cgccccggccccgcgggacgcccgtcccgcttctcggagcaatggatcgc
A0A8B9MY06_BMF-02       -----------------------------------------atggatcgc
A0A8B9NIC6_BAD-01       -----------------------------------------atgttcagc
A0A8B9NIC6_BAD-02       -----------------------------------------gtgggacac
                                                                  **      

A0A8B9MPS6_BCL2L11      caagcaaccccccgaggtgaaagcgcaacgcgacggcgaaggcgggcggc
A0A8B9ME52_PMAIP1-      ----------cctg-----------------------gcagga-------
A0A8B9MY06_BMF-01       cc--cagctacctg-----------------------gaagag----gac
A0A8B9MY06_BMF-02       cc--cagctacctg-----------------------gaagag----gac
A0A8B9NIC6_BAD-01       ctggaggagttccc-----------------------ggaggagcccggc
A0A8B9NIC6_BAD-02       cccccaaatatttg-----------------------ggaggg-------
                                                             * **         

A0A8B9MPS6_BCL2L11      taccgccg---------gcggaggggccgggcccggccgcgcagctgcgc
A0A8B9ME52_PMAIP1-      --------------------------------------------ccct--
A0A8B9MY06_BMF-01       tattctag--------cctggatgggctggacgatgacgtgtttcactct
A0A8B9MY06_BMF-02       tattctag--------cctggatgggctggacgatgacgtgtttcactct
A0A8B9NIC6_BAD-01       tccccccccgcctccccctgggggggttcgcc------------cccccc
A0A8B9NIC6_BAD-02       caccccaaaacctctcatta-----------c------------cccccc
                                                                    *     

A0A8B9MPS6_BCL2L11      cccggagct---cccgccgctctgcccggctccgccgccgcggcggggcc
A0A8B9ME52_PMAIP1-      -------------gcgcaaagc----------------------------
A0A8B9MY06_BMF-01       gatgactttggacttgcaggtcagcctggtgagatgactgcaactggcat
A0A8B9MY06_BMF-02       gatgactttggacttgcaggtcagcctggtgagatgactgcaactggcat
A0A8B9NIC6_BAD-01       cattgcatttgacggggggtac--catggtggggt---gacgtggagatc
A0A8B9NIC6_BAD-02       cat--------acgagtggggc--ttggtttgggtggggatgggggg---
                                       *     *                            

A0A8B9MPS6_BCL2L11      tccgccgaggggcccgcccgccagccccggtc--------ccttcgctac
A0A8B9ME52_PMAIP1-      ---cgcgc--------------------------------cgcccgccgc
A0A8B9MY06_BMF-01       tttcacacagaaccagtcctacagctgccttctggggaggtttcaactat
A0A8B9MY06_BMF-02       tttcacacagaaccagtcctacagctgccttctggggaggtttcaactat
A0A8B9NIC6_BAD-01       cctgacac-------------ccccccttctttatttgtgccccccctcc
A0A8B9NIC6_BAD-02       ---ggcac-------------cca----ggtttgggggggcgcccactc-
                             *                                        *   

A0A8B9MPS6_BCL2L11      tcgctctcccctcttcatcttcgtgc--------------------ggag
A0A8B9ME52_PMAIP1-      tccc------------------------------------------gcag
A0A8B9MY06_BMF-01       tccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcag
A0A8B9MY06_BMF-02       tccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcag
A0A8B9NIC6_BAD-01       tccc------------caatttttcc-------------------agagg
A0A8B9NIC6_BAD-02       -ccc------------ttattctccc--ttccgagaaggggggggggagg
                         * *                                          *  *

A0A8B9MPS6_BCL2L11      gtcgccg-----------ctgctgtcgcgttcctccagcgggta------
A0A8B9ME52_PMAIP1-      ggcggga-------------------------------------------
A0A8B9MY06_BMF-01       gacaaggcaactcaaacactcagcccgtcctcttccagtcaggatgttat
A0A8B9MY06_BMF-02       gacaaggcaactcaaacactcagcccgtcctcttccagtcaggatgttat
A0A8B9NIC6_BAD-01       ggcgggg---------------------------ccggctggga------
A0A8B9NIC6_BAD-02       ggcgggg---------------------------ccggctggga------
                        * *                                               

A0A8B9MPS6_BCL2L11      -cttctccttcgacgccgagcgcagccccgcgcccctcagttgcgacaag
A0A8B9ME52_PMAIP1-      -------ggtggaggc----------------------------------
A0A8B9MY06_BMF-01       gttgccttgtggagtcactgaagagccccggagac-tcttctatggcaat
A0A8B9MY06_BMF-02       gttgccttgtggagtcactgaagagccccggagac-tcttctatggcaat
A0A8B9NIC6_BAD-01       --------gcggaggcgggggggggtcccggggacgtccccggttttcgg
A0A8B9NIC6_BAD-02       --------gcggaggcgggggggggtcccggggacgtccccggttttcgg
                                   **  *                                  

A0A8B9MPS6_BCL2L11      g-----------ccacgcagacccccagcccgccctgccaggccctcagc
A0A8B9ME52_PMAIP1-      ------------------------tcagtgcgccctg-------------
A0A8B9MY06_BMF-01       gctggttaccgtttacacgtccctccagttggctttgcgttggatcc---
A0A8B9MY06_BMF-02       gctggttaccgtttacacgtccctccagttggctttgcgttggatcc---
A0A8B9NIC6_BAD-01       ggtcgctcccgttcg---gccccccccgt--gctctggg------cc---
A0A8B9NIC6_BAD-02       ggtcgctcccgttcg---gccccccccgt--gctctggg------cc---
                                                 * *   **  **             

A0A8B9MPS6_BCL2L11      cactgcctcagcgccatggcttcccggtggcagtctcactcgctagcaga
A0A8B9ME52_PMAIP1-      --------------------------------------------------
A0A8B9MY06_BMF-01       -----------------gcacctccaagaggagcctcaggaaggtcagcg
A0A8B9MY06_BMF-02       -----------------gcacctccaagaggagcctcaggaaggtcagcg
A0A8B9NIC6_BAD-01       -----------------gc-------------------------------
A0A8B9NIC6_BAD-02       -----------------gc-------------------------------
                                                                          

A0A8B9MPS6_BCL2L11      agatgtacagcccgaaatctggattgcacaggagctgcggcgcattggag
A0A8B9ME52_PMAIP1-      -------------------------------cagctgcgcaggatcggcg
A0A8B9MY06_BMF-01       ggaagcgcgtgccgaggtgcagattgcacggaagttgcagtgcattgccg
A0A8B9MY06_BMF-02       ggaagcgcgtgccgaggtgcagattgcacggaagttgcagtgcattgccg
A0A8B9NIC6_BAD-01       -----------ccgacgctacggccgc----cagctgcggcggatgagcg
A0A8B9NIC6_BAD-02       -----------ccgacgctacggccgc----cagctgcggcggatgagcg
                                                        ** ***   * **    *

A0A8B9MPS6_BCL2L11      atgagttcaa----tgcctcgtattgt-------------ccaagaaggg
A0A8B9ME52_PMAIP1-      acaagt-----------------------------------------ggg
A0A8B9MY06_BMF-01       accagttccaccggctccacatac----------------------agag
A0A8B9MY06_BMF-02       accagttccaccggctccacatac----------------------agag
A0A8B9NIC6_BAD-01       acgagttcca---gctccaggtgctgccacgccccaagagcctggggggg
A0A8B9NIC6_BAD-02       acgagttcca---gctccaggtgctgccacgccccaagagcctggggggg
                        *  ***                                         * *

A0A8B9MPS6_BCL2L11      gtttctt----------ggataaccaggcaggaaacccccagatcatcat
A0A8B9ME52_PMAIP1-      acct--------------------gcggcagaag--------------a-
A0A8B9MY06_BMF-01       gcatcagcagaacagaaatcaagtgtggtggcag--------------ct
A0A8B9MY06_BMF-02       gcatcagcagaacagaaatcaagtgtggtggcag--------------ct
A0A8B9NIC6_BAD-01       gcccccccagggcgggagg-gggggtggcgggag--------------a-
A0A8B9NIC6_BAD-02       gcccccccagggcgggagg-gggggtggcgggag--------------a-
                                                  **  * *                 

A0A8B9MPS6_BCL2L11      tttgcgcctcctgcgttacatcatccgcctcatctggaggatgcagacac
A0A8B9ME52_PMAIP1-      --------tcctg-----------------------------------aa
A0A8B9MY06_BMF-01       ttttctcttcctacacaactt---------------------------gg
A0A8B9MY06_BMF-02       ttttctcttcctacacaactt---------------------------gg
A0A8B9NIC6_BAD-01       --------ccctacg---------------------------------gg
A0A8B9NIC6_BAD-02       --------ccctacg---------------------------------gg
                                 ***                                      

A0A8B9MPS6_BCL2L11      cctggagcagggggatgagcagga-----------------tgggactgt
A0A8B9ME52_PMAIP1-      cct----------------------cctcacgaagctattct--tcccgg
A0A8B9MY06_BMF-01       ccttaaacgcggaggcgaacaggaaccacactggg--------------c
A0A8B9MY06_BMF-02       ccttaaacgcggaggcgaacaggaaccacactggg--------------c
A0A8B9NIC6_BAD-01       cct--ggtggggggcccgacgccccccccgccccgctcccccggcccccc
A0A8B9NIC6_BAD-02       cct--ggtggggggcccgacgccccccccgccccgctcccccggcccccc
                        ***                                               

A0A8B9MPS6_BCL2L11      cggcctga
A0A8B9ME52_PMAIP1-      agacgtga
A0A8B9MY06_BMF-01       agaggtga
A0A8B9MY06_BMF-02       agaggtga
A0A8B9NIC6_BAD-01       cgccctga
A0A8B9NIC6_BAD-02       cgccctga
                         *   ***

© 1998-2022Legal notice