Dataset for CDS Unclassified of organism Cheloniid poxvirus 1

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A890ULX1_uncFPV039-01 Putative FPV039 gene OS=[Viruses] Cheloniid poxvirus 1 (length=543 residues).
atggatccttccgttaaaaaagacgaaatatactacacaattttaaacattatacagaattactttatagaatattgtac
aggtaaaaacaggaactttcacgtagaagatgaaaatacttacattatagttaaaaatatgtgcgatatcattttaagag
ataatatcgttgagtttagaaaagatattgatagatgtaacaatataagagataattttcaagaaatagtatctaatact
atacgcgataagataacatggggtagaataataagcataatagcatttggagcgtatatcactaaagtatttaaggagca
aggaaatgatgatttagcatatagaatgcctgatatagtaacagaatcacttttagttaagtgtagaacttggataataa
ctcaggatcattggaatggtttgcataaatacatttctagtcatgaaaagtttagttacttaacgtattatattaaagca
gcagcgtttattattacatcactagctgtagctaattttttttttgtagaatcacataattga
© 1998-2022Legal notice