Dataset for CDS 097R of organism Epizootic haematopoietic necrosis virus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A7G9TL46_097R-01 097R gene OS=[Viruses] Epizootic haematopoietic necrosis virus GN=097R (length=414 residues).
atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcctgcgcccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcattgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacaccgtcaggacctttccatct
agcatggatagggcagaggttgctctgactaaatttatacaggacccaaagatagacgagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
tcttgttctcttga
>gnl|bcl2dbcds|D3TTY2_097R-01 097R gene OS=[Viruses] Epizootic haematopoietic necrosis virus GN=097R (length=414 residues).
atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggtggccctgagggccgccgcggacgccgtggg
ggtagacaacagggcctgcgcccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcacgcatccctcc
tgggagacggcattgtaaactggggcagggtggccgcgtttatgcacatctgcaggtacaccgtcaggacctttccatct
agcatggataggacagaggttgctctgactaaatttatacaggacccaaagatagacgagcacctcagagagtggacaga
taggctgggtacagtcggggtgattgggagatgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
tcttgttctcttga
© 1998-2022Legal notice