Dataset for CDS Unclassified of organism Sinocyclocheilus anshuiensis

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A671R5G8_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=531 residues).
atgtcctgttggttgagggaacaaactttgttgctggcagaagattacatcagcttctgcagcgggatccaacagacgcc
tcccagcgagtcagcagaggccatgagatacctggccaacgagatggaacagcagcacagaaccaaattcagatccctct
cccaggagttcctggacacctgcggatcagatcccagcaagtgtctgcagcgcgtcatgagggaactggtgggagatggg
aaactgaactgggggagggtggtttccatctttactttcactggagtgctggccagagagctactgtccaagggagagaa
ttccgactgctcccggagattggctgagaccattgctgactaccttggaggggaaaaacaggactggctgatggaaaacg
gaggctgggagggtttctgcaggtttttccacaacgcaagacagctgaaccaagagtcctcgatgaagacagcactgttt
gcagcagcaggagtgggtttagctggtctaacctttctcttagtacgctaa
>gnl|bcl2dbcds|A0A671SIZ0_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=597 residues).
atgacatctgactgctgtttgcgcaactgtcggtggagagcgcagtctgacatcgctgggaggaaaatgtcctgttggtt
gagggaacagactttgttgctggcagaagattacatcagcttctgcagcgggatccaacagactcctcccagcgagtcag
cagaggccatgagatacctggccaaagagatggagcagcagcacagaaccaaattccgatccctctcccaggagttcctg
gacacctgcggatcagatcccagcaagtgtctgcagagcgtcatgagggaactggtgggagatgggaaactgaactgggg
gagggtggtctccatctttactttcactggagtgctggctagtgagctcctgtccagaggagagaattccaagtgctccc
ggagactggccgagaccatcgctgactaccttggaggggaaaaacaggactggctggtggaaaacggaggctgggagggt
ttctgcaggtttttccacaccgcaagacagctgaaccaagagtcttcgatgaagacagcactgtttgcagcagcaggagt
gggtttagctggtctaacctttctcttagtacgctaa
© 1998-2020Legal notice