Dataset for CDS Unclassified of organism Pseudonaja textilis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A670ZE69_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Pseudonaja textilis (length=480 residues).
cgggatggctcaggaacccagctccccggagccggcccagggagagcgaggcgaaccatgccgggcgcgctccgcgaaga
gacggcgcagctgctgggcgactacgtgcagcaccggctggggggcgcggcgccgctgcctccgccgagccgcacggccg
agacgttgcgccgggtggccgacgagctggagagccgcgagcgcctcttcttccgcaacgcctgcagcgccgccgctttg
cccgagcccggcgaggcggcggtggttttgctgggccgggtggccacgcagatggaagccgaaggcggcctgaactgggg
ccgggtggtggcgctggtcgtgttcgccggcaacctggcggcggcgctggccgagcggggcggcccggatcacagcggcg
cgctggtggaggcgctggccgcctacctggccgaggaacggcgggactggctggaggcgcacggcggctgggtaagcgcg
© 1998-2020Legal notice