Dataset for CDS vNR13 of organism Podarcis muralis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A670KGT8_vNR13-01 vNR13 gene OS=[Eukaryota] Podarcis muralis GN=vNR13 (length=552 residues).
atgccgggcgcgctgcgcgaggagacggtgcagctgatggccgactacttgcagcaccggctcggcggcggcgggggcgc
cgcggcgctgccgcccagccgcacggccgagacgctgcggcgggtggccgacgagctggagagccgcgagcggcccttct
tccgcagcgcctgcacggcggccgccttgccgcaggagccgggcgaggcggccgcgctgctgggccgggtggcggcgcag
atggaagccgagggcggcctcaactggggccgggtggtggcgctggtcgtgttcgccggcaacttggcggcggcgctggc
cgagcgcggcgctcgcgaccagacggccgctctggcggaggcgctggccgcctacttggccggggagaagcgagagtggc
tggaggcgcacggcggctgggatggcttctatcacttcttcaacaaacatggctcggatgcagctgaccagaacagtacc
ataagcaatgctataatggcggcagctggctttggcttggctggcttggccttcctcctggcggtgcgataa
© 1998-2020Legal notice