Dataset for CDS Unclassified of organism Electrophorus electricus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4W4ETM5_uncvNR13-01 Putative vNR13 gene OS=[Eukaryota] Electrophorus electricus (length=531 residues).
atgtcctgttggttgaggaaagagactttggtgttggcagaagattatattgacttctgcaccgggatccgacggacacc
tcccagcgagtcagccgaggccatgcgctgcctggccaaagagatggagcgccagcacctctccaagttccgctccctgt
cccagaggctcctgggggcgtgcggctcagaccccagcacctgccttcgcagtgtcatggctgagctggtcaacgatggc
aagctgaactggggccgagtggtgtcgctcttcacgttcacgggcgtgctggccaccgagctgttctccaggggagaggg
gccagagtgctgccggagtctggccgagacgatagcagactatctgggaggagagaagcgagactggctggaggaaaacg
aaggctgggagggtttttgcaggttcttccgcggtatgggccacgtgggtcaggagtcctccatgaagacagcccttttc
gccgccgctggagtcggtcttgcgggcctgacgtttctcctggtgcgctga
© 1998-2020Legal notice