Dataset for CDS herpesviridae of organism Aquila chrysaetos chrysaetos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663ECE3_vNR13-01 vNR13 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=vNR13 (length=534 residues).
atgccgagctcgctgaaggaggagacggcgctgctgctggaggactacttccagcaccggggcggcggcgccgcgctgcc
ccccagccccacggcggccacgctgcggcgggcggcggccgagctggagcggcgggagcggcccttcttccgctcctgcg
cgccgctggcgcgggccgagccgcgggaggcggcggcgctgctggagcgggtggcggcgcagctggaggccgagggcggc
ctcaactggggccggctgctggcgctggtggtcttcgccggcacgctggccgccgcgctgaccgagcggggctgcggcga
cgggccgcgctgcctggccgccgcgctggccgcctacctggccgaggagcggggcgagtggctggaggcgcacggcggat
gggatggcttctgtcgcttcttcggcagacatggctcccagccggctgaccagagcagtaccataagcaatgccatcatg
gctgcggcggggtttggaatagcaggattggcttttctcttggtggtgcggtag
© 1998-2020Legal notice