Dataset for CDS Unclassified of organism Porcine mastadenovirus B

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A5P9VJA7_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Porcine mastadenovirus B (length=459 residues).
atggatctcttggatcacattttggcggactactcctacttgaggcacttggttcagcagacggccaagggcctctcctg
gtggcagcgctacctgtggggctcggcattgttggtcaccgtggaagatattcttcgggcacacgagtccagctttggag
cttttgaccacgttcaacaagcttgtgatgatctgaggagcggtgatcctactgcggttttggaacagattttgcctgtg
gttcctttgcatactcctggccacgtgttgacagctattgctttctgtgcctacctggtccggcgttgcagcattggtac
tcccctgacacctggatttattctagataccatctgtctgcatctatggctgatgctgaggagagacgccttccgccgca
accacggaacctcgccggatttctccctgcaggacgccatcccgcctcacttagagtga
>gnl|bcl2dbcds|A0A7H0S529_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Porcine mastadenovirus B (length=459 residues).
atggatctcttggatcacattttggcggactactcctacttgaggcacttggttcagcagacggccaagggcctctcctg
gtggcagcgctacctgtggggctcggcattgttggtcaccgtggaagatattcttcagaaacacgagtccagctttggag
cttttgaccacgttcaacaagcttgtgatgatctgaggagcggtgatcctactgcggttttggaacagattttgcctgtg
gttcctttgcatactcctggccacgtgttgacaggaattgctttctgcgcctacctggtccggcgttgcagcattggcac
tcccctgacacctggatttattctagataccatctgtctgcatctatggctgatgctgaggagagacgcctttcgccgcg
accacggaacctcgccagatttctccctggaggacgccatccggcctcacttagagtga
© 1998-2022Legal notice