Dataset for CDS Unclassified of organism Porcine mastadenovirus B

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A5P9VJA7_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Porcine mastadenovirus B (length=459 residues).
atggatctcttggatcacattttggcggactactcctacttgaggcacttggttcagcagacggccaagggcctctcctg
gtggcagcgctacctgtggggctcggcattgttggtcaccgtggaagatattcttcgggcacacgagtccagctttggag
cttttgaccacgttcaacaagcttgtgatgatctgaggagcggtgatcctactgcggttttggaacagattttgcctgtg
gttcctttgcatactcctggccacgtgttgacagctattgctttctgtgcctacctggtccggcgttgcagcattggtac
tcccctgacacctggatttattctagataccatctgtctgcatctatggctgatgctgaggagagacgccttccgccgca
accacggaacctcgccggatttctccctgcaggacgccatcccgcctcacttagagtga
© 1998-2020Legal notice