Dataset for CDS adenoviridae of organism Human adenovirus E serotype 4

[Download (right click)] [Alignment] [Repertoires]

18 sequence(s)

>gnl|bcl2dbcds|A0A3G8W6L2_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=555 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcccaggaacgccaacgc
cgccagcggcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggaggaggaggagtag
>gnl|bcl2dbcds|P10406_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=429 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctctcacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctagtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|Q2KSG6_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=552 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcccaggaacgccaacgc
cgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggaggaggagtag
>gnl|bcl2dbcds|Q2KSG6_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=420 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctgccggtacagccgctag
>gnl|bcl2dbcds|Q2KSG6_E1B19K-03 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=1485 residues).
atggagtcaagaaacccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcc
caggaacgccaacgccgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggagga
ggagtagctgacctgtttcctgaactgcgccgggtgctgactaggtctttgagtggtcgggagaggggtattaagcggga
gaggcatgatgagactaatcatagaactgaactaactgtgggtctaatgagccgcaagcgtccagaaacagtgtggtggc
atgaggtgcagatgactggcacagatgaggtgtcagtcatgcatgagaaattttccctagaacaagttaaaacttgttgg
ttggagcctgaggatgattgggaggtagccatcaggaattatgctaagctggctctaaggccagatagaaagtacaagat
tactaagcttataaatatcagaaatgcctgctacatctcagggaatggggctgaagtggagatctgtccgcaggatagag
tggctttcagatgctgcatgatgaatatgtacccgggggtggtggacatggatggggtcacctttatgaacattaggttt
aggggagatgggtataatgggacggtcatggccaataccaagctgacagtgcatggctgctccttctttgggtttaataa
cacctgcattgaggcctggggtcatgtcggagtaagggggtgcagtttttcagccaactggatgggggtagtgggcagga
ccaagagtatgctgtctgtgaaaaaatgcttgtttgagaggtgccatctgggggtgatgagcgagggcgaagccagaatc
cgccactgtgcctctaccgagacgggctgttttgtgctgtgcaagggcaatgccaagattaagcataatatgatctgtgg
agcctcggacgagcgcggctaccaaatgctaacatgcgccggtgggaacagtcatatgctggccaccgtgcatgtggctt
cgcatccccgcaagccctggcctgagtttgagcacaatgtcatgaccaggtgcaatatgcatctgggggctcgccgaggc
atgttaatgctctaccagtgcaacctgaattatgtgaaggtgctcttggagcccgatgccatgtccagagtaagcctgac
gggggtgtttgacatgaatgtggaagtgtggaaaattttaagatatgatgaatacaagaccaggtgccgagcctgcgagt
gcggagggaagcatgccaggttccagcccgtgtgtgtgaatgtgacggaggacctgcgacccgatcatttggtgttgtcc
tgcaccgggacggagtttggctccagcggggaagaatctgactag
>gnl|bcl2dbcds|Q2KSG6_E1B19K-04 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=501 residues).
atggagtcaagaaacccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcc
caggaacgccaacgccgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggagga
ggagtagctgacctgtttcctgaactgcgccgggtgctgactagggtaagcctgacgggggtgtttgacatgaatgtgga
agtgtggaaaattttaagatatgatgaatacaagaccaggtgccgagcctgcgagtgcggagggaagcatgccaggttcc
agcccgtgtgtgtgaatgtgacggaggacctgcgacccgatcatttggtgttgtcctgcaccgggacggagtttggctcc
agcggggaagaatctgactag
>gnl|bcl2dbcds|Q2KSG6_E1B19K-05 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=267 residues).
atggagtcaagaaacccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcc
caggaacgccaacgccgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggagga
ggagtagctgacctgccgtgtgtgtga
>gnl|bcl2dbcds|Q2KSM8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=555 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcccaggaacgccaacgc
cgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggaggaggaggagtag
>gnl|bcl2dbcds|Q2KSM8_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=429 residues).
atggagatttggacggtcttggaagacttttacaagactaggcagctgctagagaacgcctcgaacggagtttcttacct
gtggagattttgcttcggtggcgacctagctaagctagtctataggaccaaacaggattataaggaacaatttgatgata
ttttaaaagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttgttcttgacaaatggagtcaagaaac
ccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|Q2KSM8_E1B19K-03 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=1491 residues).
atggagtcaagaaacccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcc
caggaacgccaacgccgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggagga
ggaggagtagctgacctgtttcctgaactgcgccgggtgctgactaggtctttgagtggtcgggagaggggtattaagcg
ggagaggcatgatgagactaatcatagaactgaactaactgtgggtctaatgagccgcaagcgtccagaaacagtgtggt
ggcatgaggtgcagttgactggcacagatgaggtgtcagtcatgcatgagaaattttccctagaacaagttaaaacttgt
tggttggagcctgaggatgattgggaggtagccatcaggaattatgctaagctggctctaaggccagatagaaagtacaa
gattactaagcttataaatatcagaaatgcctgctacatctcagggaatggggctgaagtggagatctgtccgcaggata
gagtggctttcagatgctgcatgatgaatatgtacccgggggtggtggacatggatggggtcacctttatgaacattagg
tttaggggagatgggtataatgggacggtctttatggccaataccaagctgacagtgcatggctgctccttctttgggtt
taataacacctgcattgaggcctggggtcatgtcggagtaagggggtgcagtttttcagccaactggatgggggtagtgg
gcaggaccaagagtatgctgtctgtgaaaaaatgcttgtttgagaggtgccatctgggggtgatgagcgagggcgaagcc
agaatccgccactgtgcctctaccgagacgggctgttttgtgctgtgcaagggcaatgccaagattaagcataatatgat
ctgtggagcctcggacgagcgcggctaccaaatgctaacatgcgccggtgggaacagtcatatgctggccaccgtgcatg
tggcttcgcatccccgcaagccctggcctgagtttgagcacaatgtcatgaccaggtgcaatatgcatctgggggctcgc
cgaggcatgttaatgctctaccagtgcaacctgaattatgtgaaggtgctcttggagcccgatgccatgtccagagtaag
cctgacgggggtgtttgacatgaatgtggaagtgtggaaaattttaagatatgatgaatacaagaccaggtgccgagcct
gcgagtgcggagggaagcatgccaggttccagcccgtgtgtgtggatgtgacggaggacctgcgacccgatcatttggtg
ttgtcctgcaccgggacggagtttggctccagcggggaagaatctgactag
>gnl|bcl2dbcds|Q2KSM8_E1B19K-04 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=504 residues).
atggagtcaagaaacccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcc
caggaacgccaacgccgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggagga
ggaggagtagctgacctgtttcctgaactgcgccgggtgctgactagagtaagcctgacgggggtgtttgacatgaatgt
ggaagtgtggaaaattttaagatatgatgaatacaagaccaggtgccgagcctgcgagtgcggagggaagcatgccaggt
tccagcccgtgtgtgtggatgtgacggaggacctgcgacccgatcatttggtgttgtcctgcaccgggacggagtttggc
tccagcggggaagaatctgactag
>gnl|bcl2dbcds|Q2KSM8_E1B19K-05 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=276 residues).
atggagtcaagaaacccatttcagcagggattaccagttggatttcttagcagtagctttgtggagagcatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctaagtctccagcaaatttcc
caggaacgccaacgccgccagcagcagcaggaggatcaagaagagaacccgagagccggcctggaccctccggcggagga
ggaggagtagctgacctgccgtgtgtgtggatgtga
>gnl|bcl2dbcds|Q5GFC7_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=516 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctcttacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggaggatcaagaagagaat
ccgagagccggcctggaccctccggcggaggagtag
>gnl|bcl2dbcds|Q5GFC7_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=429 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctcttacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tcccggctacttgccggtacagccgctag
>gnl|bcl2dbcds|Q5GFC7_E1B19K-03 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=1452 residues).
atggagtcaagaaacccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggag
gatcaagaagagaatccgagagccggcctggaccctccggcggaggagtagctgacctgtttcctgaactgcaccgggtg
ctgactaggtcttcgagtggtcgggagaggggtattaagcgggagaggcatgatgagactaatcacagaattgaactgac
tgtgggtctgatgagccgcaagcgtccagaaacagtgtggtggtatgaggtgcagtcaactggcacagatgaggtgtcag
tcatgcatgagagattttccctagaacaagtcaagacttgttggttggagcctgaggatgattgggaggtagccatcagg
aattatgccaagctggctctgaggccagatagaaagtacaagattactaagctgataaatatcagaaatgcctgctacat
ctcagggaatggggctgaagtggagatctgtctccaggatagagtggctttcagatgctgcatgatgaatatgtacccgg
gagtggtggacatggatggggtcacctttatgaacatgaggttcaggggagatgggtataatgggacggtctttatggcc
aataccaagctgacagtgcatggatgctccttctttgggtttaataacacctgcatcgaggcttggggtcaggtcggtgt
taaggggtgcagtttttcagccaactggatgggggtagtgggcaggaccaagagtatgctgtctgtgaagaaatgcttgt
ttgagaggtgccacctgggggtgatgagcgagggcgaagccagaatccgccactgtgcctctaccgagacgggctgtttt
gtgctgtgcaagggcaatgccaagatcaagcataatatgatctgtggagcctcggacgagcgcggctaccagatgctgac
ctgcgccggtgggaacagtcatatgctggccgccgtgcatgtggcttcccattcccgcaagccctggcctgagttcgagc
acaatgtcatgaccaggtgcaatatgcatctgggggctcgccgaggcatgtttatgccctaccagtgcaacctgaattat
gtaaaggtgctcctggagcccgatgtcatgtccagagtgagcctgacgggggtgtttgacatgaatgtggaagtgtggaa
gattctaagatatgatgaatacaagaccaggtgtcgagcctgcgagtgcggagggaagcatgccaggttccagcccgtgt
gtgtggatgtgacggaggacctgcgacccgatcatttggtgttgtcctgcaccgggacggagttcggctccagtggggaa
gaatctgactag
>gnl|bcl2dbcds|Q5GFC7_E1B19K-04 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=465 residues).
atggagtcaagaaacccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggag
gatcaagaagagaatccgagagccggcctggaccctccggcggaggagtagctgacctgtttcctgaactgcaccgggtg
ctgactagggtgagcctgacgggggtgtttgacatgaatgtggaagtgtggaagattctaagatatgatgaatacaagac
caggtgtcgagcctgcgagtgcggagggaagcatgccaggttccagcccgtgtgtgtggatgtgacggaggacctgcgac
ccgatcatttggtgttgtcctgcaccgggacggagttcggctccagtggggaagaatctgactag
>gnl|bcl2dbcds|Q5GFC7_E1B19K-05 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=237 residues).
atggagtcaagaaacccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgcc
agcgcctgaatgcaatctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggag
gatcaagaagagaatccgagagccggcctggaccctccggcggaggagtagctgacctgccgtgtgtgtggatgtga
>gnl|bcl2dbcds|Q5GFC8_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus E serotype 4 GN=E1B19K (length=516 residues).
atggagatttggacggttttggaagactttcacaagactaggcagctgctagagaacgcctcgaacggagtctcttacct
gtggagattctgcttcggcggtgacctagctaagctagtctatagggccaaacaggattatagggaacaatttgaggata
ttttgagagagtgtcctggtctttttgacgctcttaacttgggccatcagtctcactttaaccagagaatttcaagagcc
cttgactttactactcctggcagaaccactgcagcagtagccttttttgcttttatttttgacaaatggagtcaagaaac
ccatttcagcagggattaccagctggatttcttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
tctccggctacttgccggtacagccgctagacactctgaggatcctgagtctccagcagcaggaggatcaagaagagaat
ccgagagccggcctggaccctccggcggaggagtag
© 1998-2022Legal notice