Dataset for CDS adenoviridae of organism Human adenovirus A serotype 12

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3G8WH01_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus A serotype 12 GN=E1B19K (length=492 residues).
atggagttggaaactgtgctgcaaagttttcagagcgttcgccagctcttgcagtatacctctaagaacacttcaggttt
ttggagatatctgtttggctctaccttaagcaaggtggtaaatagggtgaaagaagactatagagaggaatttgaaaaca
tattggccgactgtccagggcttttggcttcactagacctttgtcaccacttggtgtttcaggaaaaagtggtcagatcc
ttagatttttcatctgtgggacgaacggttgcttctattgcttttttggcaaccatattggataaatggagcgagaaatc
ccacttgagttgggattacatgctggattacatgtcaatgcagctgtggagggcatggctgaagaggagggtttgcattt
actcgctggcgcggcctttgaccatgcccccgctgccgacgttgcaagaggagaaggaggaggagcggaaccctgcggtg
gtggagaagtaa
>gnl|bcl2dbcds|P04492_E1B19K-01 E1B19K gene OS=[Viruses] Human adenovirus A serotype 12 GN=E1B19K (length=492 residues).
atggagttggaaactgtgctgcaaagttttcagagcgttcgccagctcttgcagtatacctctaaaaacacttcaggttt
ttggaggtatctgtttggctctaccttaagcaaggtggtaaatagggtgaaagaagactatagagaggaatttgaaaaca
tattggccgactgtccagggcttttggcttcactagacttgtgttaccacttggtgtttcaggaaaaagtggtcagatcc
ttagatttttcatctgtgggacgaacggttgcttctattgcttttttggcaaccatattggataaatggagcgagaaatc
ccacctgagttgggattacatgctggattacatgtcaatgcagctgtggagggcatggctgaagaggagggtttgcattt
actcgctggcgcggcctttgaccatgccgccgctgccgacgttgcaagaggagaaggaggaggagcggaaccctgcggtg
gtggagaagtaa
>gnl|bcl2dbcds|P04492_E1B19K-02 E1B19K gene OS=[Viruses] Human adenovirus A serotype 12 GN=E1B19K (length=1449 residues).
atggagcgagaaatcccacctgagttgggattacatgctggattacatgtcaatgcagctgtggagggcatggctgaaga
ggagggtttgcatttactcgctggcgcggcctttgaccatgccgccgctgccgacgttgcaagaggagaaggaggaggag
cggaaccctgcggtggtggagaagtaaacatggaacaacaggtgcaagaaggccatgtacttgagcgtggcgaagggcct
agttgcgcagatgatagagataagcaggaaaaaaaagaaagtttaaaggaagctgctgttcttagtaggctaactgttaa
tctgatgtcccgcccgcgtttggaaactgtatattggcaggagttgcaggatgaatttcagcggggtgatatgcatttac
agtacaaatacagttttgaacaattaaaaacccactggttagagccatgggaggatatggagtgtgctattaaagctttt
gctaaattggccttacgtcctgattgtagctacagaattactaaaacagtaaccattacttcatgcgcctatattatagg
taacggggcagaagttgaggtagatacaagcgacagagttgcttttagatgtcgaatgcagggtatgggcccaggggtgg
tgggtttggatggaattacatttataaatgttaggtttgctggagataagtttaaaggcattatgttcgaagctaatacc
tgtcttgtcttgcatggtgtttactttcttaactttagtaacatttgtgtagagtcttggaataaggtttctgctagggg
ctgtactttttatggatgttggaagggtttggtgggtagaccaaaaagtaaactgtctgtaaaaaagtgtttgtttgaaa
aatgtgtacttgctatactgaatgagggggatgcacatattaggcataatgcagcttcagaaaatgcctgttttgtatta
ttgaagggaatggctattttaaagcataatatggtttgtggggtgtctgatcaaactatgcgacgttttgttacctgtgc
tgatggaaattgtcataccttaaaaactgttcatattgtgagccacagtagacattgttggcctgtatgtgatcataaca
tgtttatgcgctgtaccatacatttaggcttaaggcggggtatgtttagaccttcccaatgtaacttcagccactcaaac
attatgctggaacctgaagtgttttctagagtgtgtttaaatggggtatttgatttatctgtggaattatgtaaggttat
aagatataatgatgatactcgacatcgttgccgacagtgtgagtgtggtagcagtcatctagaacttcgtcccattgtgc
taaatgtaactgaggagctgagaagtgaccaccttaccctgtcttgcctgcggactgactatgagtcaagtgatgaagac
gacaactga
© 1998-2022Legal notice