Dataset for CDS Unclassified of organism Guinea pig adenovirus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6H1TFX1_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Guinea pig adenovirus (length=687 residues).
atggagctggcagagtacctggagaactttgccgtgctgcgtcgcgtgttgtatcagagcagcgaccgctacggggactg
gtggcgttggttgacggggtacaagctagcccgtctggtgcacgaggtgcgcgccgagcaccggtacagcttcgaggccc
tgtgtggggacgaggtgctgcagcggctgctgcgcgatcagggtcgccggctcgagcctttctttcattccgtgttggat
ttttccaccgcggggcgctcggtgaccagtttggcttttgccgtgcacgttttgggtgctctgactcgtgacggtcgcgg
tcagcccctgtccgacgatttttggttggataccgtgtgcgtggccgtgcaccgggcgatatgtctgaccctgcagtgcc
accggcgtcggagccgaggcagcaggggggcgcgtcggcgggaggcatcctcgggcagtttagatttggcggacgctttg
ccccagccgcccccgtcgccgccgtcgtcgacggtgaccgcgcaagtggagaggatgcagaggcgggacagcagtcgggg
gatggacgccgagggggcggcggaggcggcggaggcgacggcggcggcgacgcagaggagagaggagcaggtgcgtcgcg
ctctgcggtcggatctgtcgaccacgccgcggcggggggcgttttag
© 1998-2020Legal notice