Dataset for CDS Unclassified of organism Bat mastadenovirus

[Download (right click)]

6 sequence(s)

>gnl|bcl2dbcds|A0A3G9ET96_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=519 residues).
atggatccactgagcgcttgcaactcttatgattcttttagacatatgataagggggtcgttactgccacctggttggat
aaggaggtggtgtttatcttctctttcagatattgtaggaacaatctctgtgtctagtgaagctagatttacatattctt
tacctgacgaccacctgttttggtctttattcaagaagggctttacaataggctgctgtaatgagctgtttgaacctgta
gatctaagtaataggggcagggtgcttgctttttttgcatttgtgagttttttgcttcgcaaatggcctgctgactctgt
ggtgccccagggagagagacttgacttaatttgtgtgccagcatggagcagaatgcagctgtggaagcaagcaacggcgg
tgctggagaaagaggacgaggaagacaaggcggaggcagacgacgattcagaggaagaaactcttgtggagcagtctggg
acagacactggggacagcgacgaggctctccgggaatag
>gnl|bcl2dbcds|A0A894JCI7_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=453 residues).
atggacattttgaatcctattacttcttttgagtgtttaagaaaaattataaagggttcttcttgtgaggtttctgattg
gggtcgcttgctgtggtatcctagattgtctactttagtttatagggtaaagttacattacttggaggagttgagtaact
tacttccttcagatggtactctgtggcaagacttatattctttgaatacttttcctttaaattttatgttaggggagata
gatttacagaaccggggtaggtgcttagctgcttttgcccttgtaagttttattttggacaggtgggactgcactgacgt
tgattacaaattagatttactgatagctcctctatggcagagaataatcaaggagaaaatgaagaacagcggttgcatgc
tgctgtgcagcagtacctgcgagaaagacctatatttgttagaccaagactag
>gnl|bcl2dbcds|A0A894JF83_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=540 residues).
atggatctcttgcgcgcttgcagtacttactctgcttttaaatatatgatgaaggggagcacttataactctgggtgggt
taggagatggtgttttccggggctttcagaggtggtcgggactttggctgagactcactcttatagattctggaacatga
tgcccaggcggcatttgtattgggatttagttaggcgtgggtattgtacctctttttttgaaataatgtttcgcaaggca
gatttgagcaaccgggggcgcgtattagcctacttggcctttgtgtctttcttgctgagaaactggcctcaggactctgt
tgttcctgaagcggatagacttgatttaatttgtattccagcatggaccagaatgcagtcttggcagcaaacggtgaccc
taatgcaggaaatagaggagacccagcaaggcaccggggcagaggaatgtacagacgccgagcaggccttcgtggaggag
gaggagcagggcggagggagcagtcccgacccccttacggagggctcgatgcagccctag
>gnl|bcl2dbcds|A0A894JI46_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=528 residues).
atggatattttgagtctttgcaataattattctacatttaaaaatattgttagggggtcaacttatggaccgggtttagt
tagaagatggtgttttcctgctttatcggatatagtgggaactattgcagaggagaatgcttacaggttttggggagtta
tgcctagcagtcatatatattgggactttgtaaaaagagggtattgtacttcttttttccaaactatgtttcatatggcc
gatttaagcaaccgggggcggctactagcttttttagcatttgtttgttttttgttgaaaaattggcccaaggggtctgt
tgttcctgaagcggatagacttgatttaatttgtgttccagcatggagccgcctgcagttgtggcagcaaacgatgacca
taatgcagcagctagaggaggaccaacaagaaaccgggggagaggagtgtggcgacgacgagatggaaggggaggaggaa
gaggagctggaagggggggacagcgaccacctccttatagaggactag
>gnl|bcl2dbcds|A0A894JJY3_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=546 residues).
atggatctcttgcgcgcttgcagtacttactctgcttttaaatatatgatgaaggggagcacttataactctgggtgggt
taggagatggtgttttccggggctttcagaggtggtcgggactttggctgagactcactcttatagattctggaacatga
tgcccaggcggcatttgtattgggatttagttaggcgtgggtattgtacttctttttttgaaataatgtttcgcaaggca
gatttgagcaaccgggggcgcgtattagcctacttggcctttgtgtctttcttgctgagaaactggcctcaggactctgt
tgttcctgaagcggatagacttgatttaatttgtattccagcatggaccagaatgcagtcttggcagcaaacggtgaccc
taatgcaggaaatagaggagacccagcaaggcaccggggcagaggaatgtacagacgccgagcaggccttcgtggaggag
gaggaggaggagcagggcggagggagcagtcccgacccccttacggagggctcgatgcagccctag
>gnl|bcl2dbcds|A0A8G0RCZ3_uncE1B19K-01 Putative E1B19K gene OS=[Viruses] Bat mastadenovirus (length=876 residues).
atggactacctcaagtttttatgcaactatccagtgctgaaacggattattcgggacgccagtgaaagaactggaccttg
gcgacgctatttcttctgtgggcctttggtgaattttgtgcataaaatcaaggaagagcacaaggatgattttgctcagt
gtttggattcagatggacattttctagaacaacttcgcagtggggatttaaggctttacagtgatcaagttgtgcactac
ttgtacttggaaaatcccgggcgcgtttcaatcagcttggcttttgtggcttggttgcttgatcagtgggatttggataa
tcagttttcaccagagtttgctttggaagctttgtgcattccactatggaagctcatcaaggcagaggtacagaagcggg
atctgggaacagcagcccaagtttttcgggaggagatggagagggagggtcttctggatcccccagcctccttagccccg
gagaccccaccacagagggaggatacggaggagggggggttgcatctggcggagccagcggtagtggaggagagcgagga
ggagagtctgggggaagaggagatggaagaagtggagacggaggtggactcggagctggaagtagtttttgcctcggaca
acgaggtgctgagtccgaggctggatgtagcttctggtctgagcagcagcagcgaggaagtggcttgtatcaccccattg
agcgggaccgctccactggcctcttcggacagctcctgctcagatctagaagaagaagagagggaagagcctcagagagg
ggagcccgcacaccgcgtgagcgtgatcgttcgcgctccaggtcgcgggacagaaggggagagcacacagaaatag
© 1998-2022Legal notice