Dataset for CDS BCL-2-like of organism Equus asinus asinus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C4L1K6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Equus asinus asinus GN=BCL-2 (length=699 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccgcgcccctgggggccacccccgtgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctccccgctgctacccccggccgcccccgccggcgccgcgggacctgccctcagc
cctgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgactttgccga
gatgtccagccagctgcacctgacgcctttcaccgcgaggggacgctttgccacggtagtggaggagctcttcagggatg
gggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcg
cccctggtggacaacatcgccctgtggatgactgaatacctgaaccggcacctgcacacctggatccaggataacggagg
ctgggacgcctttgtggaactgtacggccccagcatgcggccgctgtttgatttctcctggctgtctctgaaggcgctgc
tcagtctggccctggtgggagcttgtatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C4L244_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus asinus asinus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttggcggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgcccccctccaggctgcgtttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcgccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggatatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C4L2X1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A8C4LWK5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagccgctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagactcggc
tggccgactggatccacagcagtggaggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcattgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8C4PQL1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2A1 (length=525 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gacggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
actggaaagatgtgtgaaatacttttcctgaagcaatactattga
© 1998-2022Legal notice