Dataset for CDS BCL-2-like of organism Bos indicus

[Download (right click)] [Alignment] [Repertoires]

25 sequence(s)

>gnl|bcl2dbcds|A0A4W2BWN1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A4W2BWN1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos indicus GN=BCL-2 (length=612 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggatgaccgagtacctgaaccggcacctgcacac
ctggatccaggacaacggaggctgggtaggtgctcgtctggatgtgagtctgagcgggacacctcggtcccagtgcggtc
cgagtggtggggtgtggctgggcccagggtcaagggcaggccggtggagtaa
>gnl|bcl2dbcds|A0A4W2C0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2CQV1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcaggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2D608_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=717 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtggtatgaaagaacacagaactgagaccccagaagggagagagtcagatatggaaacccccaatagccccacagtga
atggagccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggag
gcaagcaatgagtttaaactttggtaccaacagacattcagcgacctgacgtcccagctccgcatcaccccagggacagc
atgtcagagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctcct
tcagtgggacaatatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccact
tacctaaataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatac
aacaaacgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgtcgcaggcctcgcaaacctca
tttcaaacacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2D6A3_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2D770_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A4W2D770_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=591 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccgga
aggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
ctggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactg
gggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcg
aaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2DYC0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Bos indicus GN=BCL2A1 (length=684 residues).
atggaaaaggaatttgaagatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaa
gaaacttctgggcaagtgtattgcctcagacatggacatgtgcaaggacatttctttctttgtggcggagttcatcaccg
aaaatacaggagagtggataaagcaaaatggaggctgggtgtttacccataatgaatatcaaaagtccaaaagagtgtcc
atctttctgagcatgccagatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaaaacctgctttat
cccgcggtaccagttgcagagcaatcacatggatatggtgaagttagcatcgccagaggaaatcgctttgctgcccagaa
cttcctggaacattcagcagcccggtgaggatgaagttctggaggaggccttgtcaacagggggacttgacctcatcttc
gtgccgggtctcgggttcgacaaacagagcaaccgtttgggacggggcaagggctactatgacgcctacctgaagcgttg
tctgcagtcccaggacgtgaaaccctacaccctggccttggctttcaaagagcagatctgcctccaggtcccggtgaatg
agaatgatgtgaaggtagacgaggtgctttacgaagactcctga
>gnl|bcl2dbcds|A0A4W2DYC0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Bos indicus GN=BCL2A1 (length=606 residues).
atggcggcagcggtggccgtgagcggcgccaagcggagcctgcgggccgagctgaagcagcgtctgcgggcgctgagcgc
tgaggagcggctgcgccagtcccacctcttggcccagaaggtgtttacccataatgaatatcaaaagtccaaaagagtgt
ccatctttctgagcatgccagatgaaattgagacagaggagatcatcaaggacattttccgacaaggcaaaacctgcttt
atcccgcggtaccagttgcagagcaatcacatggatatggtgaagttagcatcgccagaggaaatcgctttgctgcccag
aacttcctggaacattcagcagcccggtgaggatgaagttctggaggaggccttgtcaacagggggacttgacctcatct
tcgtgccgggtctcgggttcgacaaacagagcaaccgtttgggacggggcaagggctactatgacgcctacctgaagcgt
tgtctgcagtcccaggacgtgaaaccctacaccctggccttggctttcaaagagcagatctgcctccaggtcccggtgaa
tgagaatgatgtgaaggtagacgaggtgctttacgaagactcctga
>gnl|bcl2dbcds|A0A4W2DYC0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Bos indicus GN=BCL2A1 (length=528 residues).
atgactgacactgagtttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggcaagtg
tattgcctcagacatggacatgtgcaaggacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtgga
taaagcaaaatggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgcctgaagcaatactattga
>gnl|bcl2dbcds|A0A4W2EB77_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=555 residues).
atggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccgggcactcc
agctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaaacgtct
tgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaagaccct
ggccccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccgcagacgacccgacg
gcaggagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaa
ggcaccgcgcctggctgatgactaacggcggctgggatggattttgtctcttcttcccactcattccaccatcttgggaa
agacagctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcgtga
>gnl|bcl2dbcds|A0A4W2F845_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagtgtttcaactccatttacactactgctgctgtcgcaggcctcacaaacctcatttcaa
acacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2FG99_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2G6Q5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1098 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctggttctcccagaccagtgaagctgagatggttcatgaagtatttttcggt
gaaattttaagcaactgtgactctgctccaagttctcctgttcctgaggagctggaagcgatcaaagctcgagttaggga
gatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggca
atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
ggtgcaacagcagaagagctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatt
tagtggccatccgaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaat
ccttatttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttc
ccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
ccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=972 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaag
acagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgatacc
gtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=891 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcttggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcaatcaggaggaggaggaggagtcgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagcgatcaaagctcgagttagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctagaagcacactttcatggctgtggttcagtcaaccgcgtaactatactctgtgacaaatttagtggccatccgaaag
ggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
cagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggcttcccacgagcccgataccg
tgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggtcaggatag
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-05 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=1011 residues).
atgggaacggttctcttttctgggcacccactccagggctggaagagttcaacaagtgcatggaacgtcagagaccttct
ggaaatgctgaatttactccaaggtttcatgaggcccagccggcttctcttcacagcctccagggtcagaagccctgcct
ggcccttgatgccctcctggccctgttcttcctggcctccagcagccctcttctttcctgagttgtggctcttcccaagc
ctgcgtcccagccccgcccctctctctggacgcatctctgggccccatcatcacccggcgccgggccctccctcccgccc
cccctttctcctccctccttccttccctcccttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
atcccggcagcggcctgacccccgcccggatggcgaccccagcctcggccccagacacacgggctctagtggcagacttt
gtgggctataagctgaggcagaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacacca
agccatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtga
ccccgggctcggcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccccaactggggccgccttgtg
gccttctttgtctttggagccgcgttgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcagga
gtggatggtggcctacctggagacgaggctggctgactggatccacagcagtgggggctgggcggagttcacagctctat
acggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggct
gtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2GUJ7_BCL2L2-06 BCL2-like 2 gene OS=[Eukaryota] Bos indicus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A4W2GX13_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
© 1998-2020Legal notice