Dataset for CDS BAX of Organism Cebus capucinus imitator

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K5Q7S1_BAX-03 BCL2-associated X gene OS=[Eukaryota] Cebus capucinus imitator GN=BAX (length=474 residues).
atggacgggtccggggagcagcccagaggcgaggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatcgggggggaggcacccgagctggccctggacccggtgccccaggatg
cgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggacagcaacatggagctgcagaggatgatt
gccactgtggacacaaactccccccgagaggtcttttttcgagtggcagctgacatgttctctgacggcaacttcaactg
gggccgggttgtcgcctttttctactttgccagcaaactggtgctcaaggatagcctcctctcctactttgggacaccca
catggcagacagtgaccatctttgtggctggagtgctcaccgcctcacttaccatctggaagaacatgggctga
>gnl|bcl2dbcds|A0A2K5Q7S1_BAX-02 BCL2-associated X gene OS=[Eukaryota] Cebus capucinus imitator GN=BAX (length=480 residues).
atggacgggtccggggagcagcccagaggcgagggtgaggcgggaggcagtcgggcggaaggagggcgagcacccgagct
ggccctggacccggtgccccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcggggacgaactggaca
gcaacatggagctgcagaggatgattgccactgtggacacaaactccccccgagaggtcttttttcgagtggcagctgac
atgttctctgacggcaacttcaactggggccgggttgtcgcctttttctactttgccagcaaactggtgctcaaggtggg
cagctgcagggcagtgagcccagggattcaaaccatcataagctggggactgtctgatagcctcctctcctactttggga
cacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcacttaccatctggaagaacatgggctga
© 1998-2020Legal notice