Dataset for CDS BAK1 of Organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A4W2BYG9_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos indicus GN=BAK1 (length=636 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgtgacgagcctgacccctcctccacctcggaggagcaggt
ggcccgggacaccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagaacctagcagcaccatggggcaggtgggccgccagctcgccgtc
atcggggacgacatcaaccggcgctacgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgc
ctatgagtacttcaccaagatcgcgtccagcctgtttgagagcggtatcaactggggccgcgtggtggctctgctgggct
ttggctaccgcctggccctccacgtctaccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacggccc
catcaagagcgtagccatcgttctggctgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
>gnl|bcl2dbcds|A0A4W2BYG9_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos indicus GN=BAK1 (length=462 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgtgacgagcctgacccctcctccacctcggaggagcaggt
ggcccgggacaccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagaacctagcagcaccatggggcaggtgggccgccagctcgccgtc
atcggggacgacatcaaccggcgctacgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgc
ctatgagtacttcaccaagatcgcgtccaggccagcagcagcacccacagcctgtttgagagcggtatcaactggggccg
cgtggtggctctgctgggctttggctaccgcctggccctccacgtctaccagcgcggcctga
>gnl|bcl2dbcds|Q05KI7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bos taurus GN=BAK1 (length=636 residues).
atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgacccctcctccacctcggaggagcaggt
ggcccgggacaccgaggaggtcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgagggggcggctg
cgcctactgacccagagatggtcaccttgcacccagaacctagcagcaccatggggcaggtgggccgccagctcgccgtc
atcggggacgacatcaaccggcgctacgatgcggagttccaggccatgctgcagcacctgcagccaacagcagacaacgc
ctatgagtacttcaccaagatcgcgtccagcctgtttgagagcggtatcaactggggccgcgtggtggctctgctgggct
ttggctaccgcctggccctccacgtctaccagcgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
ttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggctgggtggcagccctggacttggggaacggccc
catcaagagcgtagccatcgttctggctgtggttttgttgggccagtttgtggtacgaagattcttcaagtcatga
© 1998-2020Legal notice