Dataset for CDS BIK of organism Vulpes vulpes

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3Q7V097_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Vulpes vulpes GN=BIK (length=558 residues).
atggggcgttggaggagggggatgctgctgacgatgtttctgccaaagcatcactcttggttttcagattgtgaaatagg
ccgaaatatacctaattccagagaagaaatgtctcactcaggacccctctccaggaacctctttctgagcaccttcctac
aggagcatggcccggaagttctggaggttccgggcatgacagatctcatggagtattatgaccctgggccctcccctaac
agcaacaacccggacgatgtggccatgcggctggccttcatcggggacgagatggaagtgagatggatgcttccccgtgt
tggcgagctgcccgggatggccatgtacagcttggcttttacctacaaccagacaggcctgagaggtgttcttagaagtt
tcctggatggtcttgctaacctcagggagaacatccgcatctggagcttcctgaccttccggaacagggtgtcccccaac
ccggggcgtgggctggtgctgtcgctgctgctgctgctggtgctgctactaggctggggcctccgcctcctccagtga
>gnl|bcl2dbcds|A0A3Q7V097_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Vulpes vulpes GN=BIK (length=450 residues).
atgtctcactcaggacccctctccaggaacctctttctgagcaccttcctacaggagcatggcccggaagttctggaggt
tccgggcatgacagatctcatggagtattatgaccctgggccctcccctaacagcaacaacccggacgatgtggccatgc
ggctggccttcatcggggacgagatggaagtgagatggatgcttccccgtgttggcgagctgcccgggatggccatgtac
agcttggcttttacctacaaccagacaggcctgagaggtgttcttagaagtttcctggatggtcttgctaacctcaggga
gaacatccgcatctggagcttcctgaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctgtcgctgc
tgctgctgctggtgctgctactaggctggggcctccgcctcctccagtga
>gnl|bcl2dbcds|A0A3Q7V097_BIK-03 BCL2-interacting killer gene OS=[Eukaryota] Vulpes vulpes GN=BIK (length=756 residues).
atgacgctcgcctgcagctccatgaggaccataggaccaaatgtcacactcagcggagtatccccagcaggtggcacagc
ctgggcccactgggaagaggctggacggagggttgcatgcctgttacgtaccccaagtttcacaaggcagttggcaggta
taaaagctggatttgctgagctgcagagaaaccaagagagcagcattagcccgttcttttcctctcctgatgggctagga
tgtggaagggggtgctcggaggatggctccatccgctggttgggtctccacgctgacctcggagaaatgtctcactcagg
acccctctccaggaacctctttctgagcaccttcctacaggagcatggcccggaagttctggaggttccgggcatgacag
atctcatggagtattatgaccctgggccctcccctaacagcaacaacccggacgatgtggccatgcggctggccttcatc
ggggacgagatggaagtgagatggatgcttccccgtgttggcgagctgcccgggatggccatgtacagcttggcttttac
ctacaaccagacaggcctgagaggtgttcttagaagtttcctggatggtcttgctaacctcagggagaacatccgcatct
ggagcttcctgaccttccggaacagggtgtcccccaacccggggcgtgggctggtgctgtcgctgctgctgctgctggtg
ctgctactaggctggggcctccgcctcctccagtga
© 1998-2020Legal notice