Dataset for CDS BCL2L11 of organism Vombatus ursinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4X2L9J9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Vombatus ursinus GN=BCL2L11 (length=426 residues).
atggcaaagcaaccgtcagatctaaattctgaatgccacagagaaggtggacaattacaccctacagaaaggcctactca
gcctcaacaactcagaccaggggcccctacctctatacaaacacagtatcaagacaggagtccagcacctatgagttgtg
acaaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatggcttccatgaggcagtct
cagtcaatacctgcagatatgcggccagaaatttggattgcacaagaattgcgacgtattggagatgagtttaatgctta
ttatccaagaagggggtttttggataataactatcaagcggatcaccaaatggttattttacgcctgttacgttacatca
tccgccttgtttggagaatgcagtga
© 1998-2020Legal notice