Dataset for CDS PMAIP1 of organism Terrapene carolina triunguis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A674JUE0_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=PMAIP1 (length=156 residues).
gtccgaggcaccaaattcggatctcgattcgaaccaccacccacacaggaagctgtgatgcagtgctctttgcaactacg
caaaataggagatatatgcaacctgcagcagaagattcttaatgttattacaaaactgttctgcccaggaacgtga
© 1998-2020Legal notice