Dataset for CDS BMF of organism Suricata suricatta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A673TA87_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Suricata suricatta GN=BMF (length=882 residues).
tgtttccaagggaaggttcgtacattcgtgaccgtccctggcagtcgcccagcccgggacttggggctccactctccatt
ggccggccgtgggcgtgacgcgcgggaggcggggcctcatcagctgtttgcgggatgccccgagcgggcgtattttggaa
acaatacggcgcgggccacggtggcctccacccgcgccagcccgccagctgccgctgccgcccctgccagcgcctcccgc
cacccgccgcagcccgctgggctctttccctccttcccaattgagtctgggcgccaagcccccgagtgttcgtcacgctg
gaccctggcgcggagccctggcatcacgactcggaggcggagactctctcctggagtcacccagcaggggagatggagcc
agcctgggagcttgctgtctgccaacctgtttgcccagagccaactggactgtcctctcagccacctgcaactcttccct
ctcacccactgctgtggccctgggcttcgacccaccagccaggaggacaaggccacccagacccttagtccggcttcccc
gagtcagggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgccggctaccggctcc
ctctccctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcaacatcgagcagaggta
cagattgcccggaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgaaatcg
agtgtggtggcaactcctcctcttcctacacaacctggccttgaatgcagaagagaacaggaatggggcaggtcccaggt
ga
© 1998-2020Legal notice