Dataset for CDS BIK of organism Suricata suricatta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A673V4V4_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Suricata suricatta GN=BIK (length=471 residues).
atgacagagccaaacagagaagaaatgtctcacgcaggacccctctccagggatgtctttttgagcaccttcctgcagga
gcatggcccggaagttctggacgttcccggcgtgactgatctcgtggagtactatgatcccgggccctcccctaacagca
acagccccgatgacgtggccatgcggctggccttcatcggggacgagatggaagtgaggtggatggtgccccgcgttggc
gagctgcctgggatggccttgtacagcttggcctttacctacaaccagacgggcctgaggggtgttctcaggagtctcat
ggacgggctcgccagcctcagggagaacatccgcgtgtggagcttcctgaccctcaggaacagggtgtccccgaacgctg
gccgtgggctggcgctgtccctgctgctgctggtgctgctgctcagctgggggctccaccacctccagtga
© 1998-2020Legal notice