Dataset for CDS Unclassified of organism Sinocyclocheilus rhinocerous

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A673GV92_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=612 residues).
atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
gagaggtggagaggtgggacaaacagctaacagacacggacgctttgaagacagatcaacgcagactgccagctctgtgc
tgaattcagtgagaaacggagatatggcaccattccagggtttagagggagatgaatcatctccctgcggagctgtggat
gccaggactgcatttggggttaactgtgtaaccgggggccttgcgtcacttactatggcccctggggcctcagaagggcc
aagagcactttttcatggaaatgctggatttcgtgcacacttccccgcactgtttgaaccagtcctggatggcacacaaa
acgcagaagaggacgaagggagaccagaagaaaaggaagacgaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagcaggatcatcttcagctgtttcttttcctcaagtggtttctgtcacg
atgtgcaatgacatcatcgtctgttatttcaatgctgcatatgcaaatatga
>gnl|bcl2dbcds|A0A673J7P6_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=270 residues).
atgtacaaaattgtactccgctctcagcctccagacgtggttctccggcagaacctgcggatgatggacccagcggcgcc
gcggcccgagcggagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggagcacatga
tgcatcatggaaaccaaaggaaccaggagccgctgtggtggcgtgtggcggtggcgttctacacgctggtattcggcaga
gaggcagacgcaaggcagaatcgcaggtga
>gnl|bcl2dbcds|A0A673MJJ4_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus rhinocerous (length=354 residues).
tttttttataggtttaacagtgtgaaatcaaaatctttccaagcacctcctggacacttaaatgaagatcagtgggtgag
gcagagggtccaatcgatggatgcagaactattttttaggaaagctgaccagccttggaggccgcgtgttttctctgctc
ctccaaacgctgctgtgagtgtgaaatacggcagacggctgaggagaatcgcagatgagtttgacattctgctcgaaaaa
gggatgaagaggatgtgtaacggcagaccggcatcacagatacggcgcttccccatgagcttaagcttcctctggagcca
cgaagagtctgacgcagagaggaggtcacactag
© 1998-2020Legal notice