Dataset for CDS BCL2L11 of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A673IWZ7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L11 (length=549 residues).
atggctgacagtacaatattgaagcaaacgctggccaatggcccggcctcgcggggaagcggagagagcgccggtggcgg
agctgtcttgcgctctgaacactttgacttccctcagccgagcgatggggacccgttaaggggagggattgccatgtcaa
atagtcaccagtcgaggtcaccgatgtcccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattct
gtgccaagttccccactaatgcccaatatttccgaagcgcaagacggccaaaatgatgaggtatggtctgccgaacctag
ccaccagcacgtgcagatggcagcacctgtcggagccatggggccggagatggcggtcgctcgggagctgcgccgcattg
gagacgagttcaaccgtctgtactgtcagggggccggtgcaggcgggaacaacgcggcccagctgcgcgctcccaacgaa
cacgccatcatcatgtggatgaacgaccttatcggacgtgtagtacagtttttcctgcgaaggagatga
>gnl|bcl2dbcds|A0A673NIJ7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L11 (length=417 residues).
ccgttaaggggagggatttccatgtcgaatagtcaccagtcgaggtcaccgatgtgccgaaccttctccaggtcctctag
tggctatttttccgtcgacagcgattctgtgccaagttccccgctaatgcccaatatttccgaagcgcaagacggccaaa
atgatgaggtatggtttgccgaacctagccaccagcacgcgcagatggcggcacctgtgggagccatggggccggagatg
gcggtcgctcgggagctgcggcgcattggagacgagttcaaccgcctgtactgtcagggggccggtgcaggtgggaacaa
cggggcccagctgcgcgctcccaacgaacacgccatcatcatgtggatgaacgactttatcggacgtgtagtacagtttt
tcctgcgaagaagatga
© 1998-2020Legal notice