Dataset for CDS BMF of organism Sinocyclocheilus grahami

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A672JWL9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BMF (length=432 residues).
atggatgaggatgaggatgatgtgcgcaggaagggtctacagcactggccttcctcccgcgttcagataaagcagaccga
gaccgcagggataccccctctatgccccagcggcatgctgccctgtcgagtgcatgtggagcccagacgctttctctacg
gtaacacaggactgctgctgctagcgccgcctagccgctctcggcctccagacgtggttctccggcagaacctgcgcatg
atggatccggcggagagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggagcacat
gatgcatcacagaaaccaaaggaaccgggagccgctgtggtggcgcgtggccgtggcgttctacacgcttttatttggaa
gagagcccaacgcaagagcaaatcgtaggtga
>gnl|bcl2dbcds|A0A672JWL9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BMF (length=393 residues).
atggatgaggatgaggatgatgtgcgcaggaagggtctacagcactggccttcctcccgcgttcagataaagcagaccga
gaccgcagggataccccctctatgccccagcggcatgctgccctgtcgagtgcatgtggagcccagacgctttctctacg
gtaacacaggactgctgctgctagcgccgcctagccgctctcggcctccagacgtggttctccggcagaacctgcgcatg
atggatccggcggagagcgtggagaccctcatcgggcagaagctccagctgatcggagatcagttctatcaggacgctcc
tttacacaaaagtgttccatgtgccgtgtttgttttggccggactgtttcctgactctggtctagttgtttga
>gnl|bcl2dbcds|A0A672RK14_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BMF (length=645 residues).
atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
gagaggtggagaggtgggacaaacagctaacagacacggacgctttgaagacagatcaacgcagactgccagctctgtgc
tgaattcagtgagaaacggagatatggcaccattccagggtttagagggagatgcatcatctccctgcagagctgtggat
gccaggactgcatttggggttaactgtggaaccgggggccttgcgtcacttactatggcccctggggcctcagaagggcc
aagagcactttttcatggaaatgctggatttcgtgcacacttccccgcactgtttgaacccctcctggatggcacacaaa
acgcagaagaggacgaagggagaccagaagaaaaggaagacgaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagcaggatcatcttcagctggtaagagtgatttcagatgagactagttc
tctgtggttttcattgcagtggtttctgtcacgatgtgcaatgacatcatcgtctgttatttcaatgctgcatatgcaaa
tatga
© 1998-2020Legal notice