Dataset for CDS Unclassified of organism Sinocyclocheilus anshuiensis

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A671NFZ6_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=219 residues).
tttactgatcagccaggatcagagactgaccagccttggaggccgcgtgttttctctgctcctccaaatgctgctgtgag
tgtgaaatacggcagacggctgaggagaatcacagatgagtttgacattctgctcgaaaaaggggtaagacgaactgaga
gcagggaattgctgttgtacttgtattcaacaaattcagtcacttgtggactgtcatga
>gnl|bcl2dbcds|A0A671NJM4_uncBAD-01 Putative BCL2-associated agonist of cell death gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=405 residues).
gtgatggcgccaaagtcgacacattcggttgaggtgtcagaaacactcaaagaccgggacgattcagatcagtcagaggc
tggatcaccacagagaaagcagctcctcgctgtgcctgatcagtgggtgaggcagagggtccaatcgatggatgcagaac
tattttttaagaaagctgaccagccttggaggccgcgtgttttctctgctcctccaaatgctgctgtgagtgtgaaatac
ggcagacggctgaggagaatcacagatgagtttgacattctgctcgaaaaagggatgaagaggatgtgtaacggcagacc
ggcaccacagatacggcgcttccccatgagcttaagcttcctctggagccacgaagagtctgacgcagagaggaggtcac
actag
>gnl|bcl2dbcds|A0A671S371_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=723 residues).
atggatgatgaggaagacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
cccacgaggagaggtgggacaaacggctaacagacacggacgctttgaagacagatcgacgcagactgccagaactgtgc
tgaattcagcgagagatggagatatggcaccattccagggtttagagagagatgcatcatctccctgcggagctgtggat
cccaggactgcatttggggctaactgtggaactgggggcctcgtgtcacttactatggcccctggggccccagaagggcc
aagagcactttttcatggaaatgctgtatttcgttcacacttccccgcattgttcgaacccgtcccggatggcacacaaa
acgcagaagaggacggagggacaccagaagaaaaggaagacgaacgtgacgtgggaattagcgtggagattcagattgga
cgtaaactgcgcgaaatgggggatcagtttcagcaggaacatcttcagctggtaagagtgatttcagatgggactagttt
cttttcctcaagtctgtggttttcactgcagtggtttctgtcacgatgtgcaatgacatcatcgtctgttatttcaatgc
tgcatatgcaaatactcagtgggagagatgacatcatttttggtttacccttatattgtgtttttgttgtagttaaaaac
tag
© 1998-2020Legal notice