Dataset for CDS BCL2L11 of organism Sarcophilus harrisii

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A7N4NUH6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L11 (length=417 residues).
atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtggacaattgcagcctacagaaaggcctactca
acctcaactcagaccaggggcccctacctctatacaaacacaatatcaagacaggagtccagcgcctatgagttgtgata
aatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatgggtaagcaagatcatgcttcc
atgaggcagtctcagtcaatacctgcagatatgcgaccagaaatttggattgcacaagaattgcgacgtattggagatga
atttaatgcttcttatccaagaaggaatgtcattgtcaccatgtggaagtttacagagagggtgttatcaattgataaat
acatcaaagtcctatga
>gnl|bcl2dbcds|A0A7N4NUH6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L11 (length=612 residues).
atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtggacaattgcagcctacagaaaggcctactca
acctcaactcagaccaggggcccctacctctatacaaacacaatatcaaggtaattcaggtgaaggggacagctgctcac
ctagcagccctcagggaccgtttgcaccacccactagccctagcccgtttgctaccagatccccacttttcatctttgta
agaagatccccactgctgcctcgatcttctagtgggtatttctcttttgacacagacaggagtccagcgcctatgagttg
tgataaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatgggtaagcaagatcatg
cttccatgaggcagtctcagtcaatacctgcagatatgcgaccagaaatttggattgcacaagaattgcgacgtattgga
gatgaatttaatgcttcttatccaagaaggggttttttggataataactatcaagcagcagatgatcatcaccaaatggt
tattttacggctattacattacatcatccgccttgtttggagaatgcagtga
>gnl|bcl2dbcds|A0A7N4NUH6_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L11 (length=549 residues).
atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtggacaattgcagcctacagaaaggcctactca
acctcaactcagaccaggggcccctacctctatacaaacacaatatcaaggtaattcaggtgaaggggacagctgctcac
ctagcagccctcagggaccgtttgcaccacccactagccctagcccgtttgctaccagatccccacttttcatctttgta
agaagatccccactgctgcctcgatcttctagtgggtatttctcttttgacacagacaggagtccagcgcctatgagttg
tgataaatctacacaaactccaagccctccttgtcaagccttcaatcattatctaagtgcaatggcttccatgaggcagt
ctcagtcaatacctgcagatatgcgaccagaaatttggattgcacaagaattgcgacgtattggagatgaatttaatgct
tcttatccaagaagggcagtgtggcatggtttcaagagctttgggattggagttggaagtcagctttga
>gnl|bcl2dbcds|A0A7N4NUH6_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L11 (length=312 residues).
atggcaaagcaaccgtcagatctaaattctgagtgtgaccgtgaaggtggacaattgcagcctacagaaaggcctactca
acctcaactcagaccaggggcccctacctctatacaaacacaatatcaagcttccatgaggcagtctcagtcaatacctg
cagatatgcgaccagaaatttggattgcacaagaattgcgacgtattggagatgaatttaatgcttcttatccaagaagg
aatgtcattgtcaccatgtggaagtttacagagagggtgttatcaattgataaatacatcaaagtcctatga
© 1998-2022Legal notice