Dataset for CDS Unclassified of organism Salmo trutta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A673WE74_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Salmo trutta (length=597 residues).
atggatgatgaagaggaggacatgtctcttcagcgtcctgtctcccagtgctggggcacccccttcagggacatcaagtt
ccacgacagggagagcagggacagagaagacacccaggacaggtctactcagacgtcgactggacccaacgccattgtcc
cacggtcagagggacaaaacatcatggtaccacaaggccacaacaacaacaactttccctgcggggtgcaggacaatcac
cagggcagaatactgttccatggcaacgctggattccgcttgcacttcccagctcggttcgagccaacggacgaccgggg
agagaggcagaacgaggagggaaggagggaggacgaggagaggaggagaatggaggaaagaccagaggaagagcgggtgg
aggatagcgcggaggcgaggatcggacgtaagctccgggagatcggagaccagttccaccaggaacatgttcaactgttc
ctgcggcatcagagggatgtcctaccagtctggattcgtctgaccatggccctctacggcttcctgtttaacagagaagc
ccctgctgtaccccacctgagaggacaggagagatga
© 1998-2020Legal notice