Dataset for CDS BMF of organism Salmo trutta

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A673YQV3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo trutta GN=BMF (length=489 residues).
atggacgatgaggaggatgatgtgtttgaaccagactcccactgctggcgcacagccttcagggagataaagtacgagga
caggggaacccagacacccagccctgtcctgccactgcccaataatatgctgccctgcggggtggcccaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagcgcagtttgagcgtgttggagaccaggggcctctggga
gagcgaggagagcgaggggggatggagaggctcaatcagcagccccagcagccagcacgcagcatagagatctgcattgg
acagaaactccaactcatcggagaccagttccaccaagaacacgttcaagtgtatcaccgaaaccaaaggaacatgaggc
ccttgtggaggcgcctggcctcggctctgctcaccctgctgtttgagcaggaggccatcgctggaggggagagagcaggg
tggaggtga
>gnl|bcl2dbcds|A0A674EF64_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salmo trutta GN=BMF (length=486 residues).
atggatgatgaggaggatgatgtgtttgtgccagactcctcccactgctggcgcacagccttcagggaaataaagtacga
ggacagaggcacccagacacccagccctgccctggcactgcccaacgacatgctgccctgtggggtggcccaggagccca
gaccactcttctacggcaacgcaggctttcgattgcactttccagcacggtttgagcaggttggagaccaggggcctcag
gagcagcatcagggggagcgagggaggatggaacggcttctacagcagccagtgcaaagcatggaggtctgcattggaca
gaaactccaactcatcggagaccagttctaccaagaacaccttcaactgtatcaccgaaaccaaaggaacatgaggccct
tgtggtggcgcctggcctcagctctgttcaccctgctgtttgagcaggaggccatcgctggaagggggagagcagggtgg
aggtga
© 1998-2020Legal notice